EMAIL THIS PAGE TO A FRIEND

HOPX

HOP homeobox

125 Gene Product Result for
Synonyms: CAMEO HOD HOP LAGY NECC1 OB1 SMAP31 TOTO
UniProtKB ID: Q9BPY8, A8K0Z2, E9PB55, G3V294, Q8N0V6, Q96CI1
Gene ID:
Human(84525) Summary: The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009]
Mouse(74318) HOP homeobox
Rat(171160) HOP homeobox
Zebrafish(386589) HOP homeobox
cow(281270) HOP homeobox
chicken(395241) HOP homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064991 MISSION® esiRNA esiRNA human HOP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032495 Rosetta Predictions human pricing
NM_139211 Rosetta Predictions human pricing
NM_139212 Rosetta Predictions human pricing
NM_133621 Rosetta Predictions rat pricing
NM_175606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017334 predicted 441
2 SASI_Hs01_00017336 predicted 312
3 SASI_Hs01_00017337 predicted 500
4 SASI_Hs01_00017339 predicted 529
5 SASI_Hs01_00017340 predicted 480
6 SASI_Hs01_00017341 predicted 421
7 SASI_Hs01_00017342 predicted 587
8 SASI_Hs01_00017343 predicted 936
9 SASI_Hs02_00359964 predicted 881
10 SASI_Hs02_00359965 predicted 847
11 SASI_Hs01_00017335 predicted 742
12 SASI_Hs01_00017338 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052878 predicted 314
2 SASI_Hs01_00052880 predicted 184
3 SASI_Hs01_00052881 predicted 367
4 SASI_Hs01_00052883 predicted 398
5 SASI_Hs01_00052884 predicted 347
6 SASI_Hs01_00052885 predicted 291
7 SASI_Hs01_00052886 predicted 456
8 SASI_Hs01_00052887 predicted 805
9 SASI_Hs02_00364234 predicted 750
10 SASI_Hs02_00364235 predicted 717
11 SASI_Hs01_00052879 predicted 617
12 SASI_Hs01_00052882 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153073 predicted 312
2 SASI_Hs01_00153075 predicted 193
3 SASI_Hs01_00153076 predicted 374
4 SASI_Hs01_00153078 predicted 400
5 SASI_Hs01_00153079 predicted 354
6 SASI_Hs01_00153080 predicted 292
7 SASI_Hs01_00153081 predicted 459
8 SASI_Hs01_00153082 predicted 815
9 SASI_Hs02_00364236 predicted 759
10 SASI_Hs02_00364237 predicted 722
11 SASI_Hs01_00153074 predicted 623
12 SASI_Hs01_00153077 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076609 predicted 498
2 SASI_Rn01_00076610 predicted 361
3 SASI_Rn01_00076611 predicted 602
4 SASI_Rn02_00267848 predicted 734
5 SASI_Rn01_00076612 predicted 344
6 SASI_Rn01_00076613 predicted 546
7 SASI_Rn01_00076614 predicted 250
8 SASI_Rn01_00076615 predicted 579
9 SASI_Rn01_00076616 predicted 778
10 SASI_Rn01_00076617 predicted 637
11 SASI_Rn01_00076618 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083507 predicted 422
2 SASI_Mm01_00083513 predicted 409
3 SASI_Mm02_00346551 predicted 418
4 SASI_Mm01_00083506 predicted 328
5 SASI_Mm02_00346552 predicted 424
6 SASI_Mm01_00083508 predicted 394
7 SASI_Mm01_00083509 predicted 398
8 SASI_Mm02_00346553 predicted 423
9 SASI_Mm01_00083510 predicted 336
10 SASI_Mm01_00083511 predicted 342
11 SASI_Mm01_00083512 predicted 345
12 SASI_Mm01_00083514 predicted 388
13 SASI_Mm01_00083515 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032495
VALIDATED
HOPX MISSION shRNA Bacterial Glycerol Stock
HOP homeobox
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032495.4-480s21c1
Sequence:CCGGAGAGTGCAGATCCGTCACAGACTCGAGTCTGTGACGGATCTGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-420s21c1
Sequence:CCGGGACCCAGAAATGGTTTAAGCACTCGAGTGCTTAAACCATTTCTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032495.4-504s21c1
Sequence:CCGGAGGAGATGGCAGGCATTGACACTCGAGTGTCAATGCCTGCCATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-808s21c1
Sequence:CCGGATCACCTCCCAGTAGCAATTTCTCGAGAAATTGCTACTGGGAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-369s21c1
Sequence:CCGGTTCCACCACGCTGTGCCTCATCTCGAGATGAGGCACAGCGTGGTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032495.3-340s1c1
Sequence:CCGGCCAGGTGGAAATCCTGGAGTACTCGAGTACTCCAGGATTTCCACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-502s1c1
Sequence:CCGGAGAGTGCAGATCCGTCACAGACTCGAGTCTGTGACGGATCTGCACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-442s1c1
Sequence:CCGGGACCCAGAAATGGTTTAAGCACTCGAGTGCTTAAACCATTTCTGGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-358s1c1
Sequence:CCGGGTACAACTTCAACAAGGTCGACTCGAGTCGACCTTGTTGAAGTTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-448s1c1
Sequence:CCGGGAAATGGTTTAAGCAGCGCCTCTCGAGAGGCGCTGCTTAAACCATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032495
VALIDATED
HOPX MISSION shRNA shRNA Plasmid DNA
HOP homeobox
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032495.4-480s21c1
Sequence:CCGGAGAGTGCAGATCCGTCACAGACTCGAGTCTGTGACGGATCTGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-420s21c1
Sequence:CCGGGACCCAGAAATGGTTTAAGCACTCGAGTGCTTAAACCATTTCTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032495.4-504s21c1
Sequence:CCGGAGGAGATGGCAGGCATTGACACTCGAGTGTCAATGCCTGCCATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-808s21c1
Sequence:CCGGATCACCTCCCAGTAGCAATTTCTCGAGAAATTGCTACTGGGAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-369s21c1
Sequence:CCGGTTCCACCACGCTGTGCCTCATCTCGAGATGAGGCACAGCGTGGTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032495.3-340s1c1
Sequence:CCGGCCAGGTGGAAATCCTGGAGTACTCGAGTACTCCAGGATTTCCACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-502s1c1
Sequence:CCGGAGAGTGCAGATCCGTCACAGACTCGAGTCTGTGACGGATCTGCACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-442s1c1
Sequence:CCGGGACCCAGAAATGGTTTAAGCACTCGAGTGCTTAAACCATTTCTGGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-358s1c1
Sequence:CCGGGTACAACTTCAACAAGGTCGACTCGAGTCGACCTTGTTGAAGTTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-448s1c1
Sequence:CCGGGAAATGGTTTAAGCAGCGCCTCTCGAGAGGCGCTGCTTAAACCATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032495
VALIDATED
HOPX MISSION shRNA Lentiviral Transduction Particles
HOP homeobox
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032495.4-480s21c1
Sequence:CCGGAGAGTGCAGATCCGTCACAGACTCGAGTCTGTGACGGATCTGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-420s21c1
Sequence:CCGGGACCCAGAAATGGTTTAAGCACTCGAGTGCTTAAACCATTTCTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032495.4-504s21c1
Sequence:CCGGAGGAGATGGCAGGCATTGACACTCGAGTGTCAATGCCTGCCATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-808s21c1
Sequence:CCGGATCACCTCCCAGTAGCAATTTCTCGAGAAATTGCTACTGGGAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032495.4-369s21c1
Sequence:CCGGTTCCACCACGCTGTGCCTCATCTCGAGATGAGGCACAGCGTGGTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032495.3-340s1c1
Sequence:CCGGCCAGGTGGAAATCCTGGAGTACTCGAGTACTCCAGGATTTCCACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-502s1c1
Sequence:CCGGAGAGTGCAGATCCGTCACAGACTCGAGTCTGTGACGGATCTGCACTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-442s1c1
Sequence:CCGGGACCCAGAAATGGTTTAAGCACTCGAGTGCTTAAACCATTTCTGGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-358s1c1
Sequence:CCGGGTACAACTTCAACAAGGTCGACTCGAGTCGACCTTGTTGAAGTTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032495.3-448s1c1
Sequence:CCGGGAAATGGTTTAAGCAGCGCCTCTCGAGAGGCGCTGCTTAAACCATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175606
HOPX MISSION shRNA Bacterial Glycerol Stock
HOP homeobox
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-332s21c1
Sequence:CCGGGGAGATCCTGGAGTACAACTTCTCGAGAAGTTGTACTCCAGGATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-426s21c1
Sequence:CCGGCAGACGCAGAAATGGTTTAAGCTCGAGCTTAAACCATTTCTGCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175606.2-803s21c1
Sequence:CCGGCCATCACCTTCCAGTAGTAATCTCGAGATTACTACTGGAAGGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-485s21c1
Sequence:CCGGTTCGGAATGCAGATCTGTTACCTCGAGGTAACAGATCTGCATTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-349s21c1
Sequence:CCGGACTTCAACAAGGTCAACAAGCCTCGAGGCTTGTTGACCTTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-425s1c1
Sequence:CCGGGCAGACGCAGAAATGGTTTAACTCGAGTTAAACCATTTCTGCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-335s1c1
Sequence:CCGGGATCCTGGAGTACAACTTCAACTCGAGTTGAAGTTGTACTCCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-483s1c1
Sequence:CCGGCCTTCGGAATGCAGATCTGTTCTCGAGAACAGATCTGCATTCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-472s1c1
Sequence:CCGGCAGAAGGCTTGCCTTCGGAATCTCGAGATTCCGAAGGCAAGCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-343s1c1
Sequence:CCGGAGTACAACTTCAACAAGGTCACTCGAGTGACCTTGTTGAAGTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175606
HOPX MISSION shRNA shRNA Plasmid DNA
HOP homeobox
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-332s21c1
Sequence:CCGGGGAGATCCTGGAGTACAACTTCTCGAGAAGTTGTACTCCAGGATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-426s21c1
Sequence:CCGGCAGACGCAGAAATGGTTTAAGCTCGAGCTTAAACCATTTCTGCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175606.2-803s21c1
Sequence:CCGGCCATCACCTTCCAGTAGTAATCTCGAGATTACTACTGGAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-485s21c1
Sequence:CCGGTTCGGAATGCAGATCTGTTACCTCGAGGTAACAGATCTGCATTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-349s21c1
Sequence:CCGGACTTCAACAAGGTCAACAAGCCTCGAGGCTTGTTGACCTTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-425s1c1
Sequence:CCGGGCAGACGCAGAAATGGTTTAACTCGAGTTAAACCATTTCTGCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-335s1c1
Sequence:CCGGGATCCTGGAGTACAACTTCAACTCGAGTTGAAGTTGTACTCCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-483s1c1
Sequence:CCGGCCTTCGGAATGCAGATCTGTTCTCGAGAACAGATCTGCATTCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-472s1c1
Sequence:CCGGCAGAAGGCTTGCCTTCGGAATCTCGAGATTCCGAAGGCAAGCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-343s1c1
Sequence:CCGGAGTACAACTTCAACAAGGTCACTCGAGTGACCTTGTTGAAGTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175606
HOPX MISSION shRNA Lentiviral Transduction Particles
HOP homeobox
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-332s21c1
Sequence:CCGGGGAGATCCTGGAGTACAACTTCTCGAGAAGTTGTACTCCAGGATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-426s21c1
Sequence:CCGGCAGACGCAGAAATGGTTTAAGCTCGAGCTTAAACCATTTCTGCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175606.2-803s21c1
Sequence:CCGGCCATCACCTTCCAGTAGTAATCTCGAGATTACTACTGGAAGGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-485s21c1
Sequence:CCGGTTCGGAATGCAGATCTGTTACCTCGAGGTAACAGATCTGCATTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175606.2-349s21c1
Sequence:CCGGACTTCAACAAGGTCAACAAGCCTCGAGGCTTGTTGACCTTGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-425s1c1
Sequence:CCGGGCAGACGCAGAAATGGTTTAACTCGAGTTAAACCATTTCTGCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-335s1c1
Sequence:CCGGGATCCTGGAGTACAACTTCAACTCGAGTTGAAGTTGTACTCCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-483s1c1
Sequence:CCGGCCTTCGGAATGCAGATCTGTTCTCGAGAACAGATCTGCATTCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-472s1c1
Sequence:CCGGCAGAAGGCTTGCCTTCGGAATCTCGAGATTCCGAAGGCAAGCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175606.2-343s1c1
Sequence:CCGGAGTACAACTTCAACAAGGTCACTCGAGTGACCTTGTTGAAGTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)