EMAIL THIS PAGE TO A FRIEND

HORMAD1

HORMA domain containing 1

74 Gene Product Result for
Synonyms: CT46 NOHMA
Gene ID:
Human(84072) Summary: This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(67981) HORMA domain containing 1
Rat(365868) HORMA domain containing 1
domestic guinea pig(100722212) HORMA domain containing 1
naked mole-rat(101696285) HORMA domain containing 1
sheep(101108094) HORMA domain containing 1
Zebrafish(436630) HORMA domain containing 1
chicken(425071) HORMA domain containing 1
domestic cat(101093125) HORMA domain containing 1
cow(529615) HORMA domain containing 1
dog(475839) HORMA domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112871 MISSION® esiRNA esiRNA human HORMAD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032132 Rosetta Predictions human pricing
NM_001108949 Rosetta Predictions rat pricing
NM_026489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222711 predicted 1201
2 SASI_Hs01_00222712 predicted 510
3 SASI_Hs01_00222713 predicted 686
4 SASI_Hs01_00222714 predicted 1370
5 SASI_Hs01_00222715 predicted 210
6 SASI_Hs01_00222716 predicted 600
7 SASI_Hs01_00222717 predicted 200
8 SASI_Hs01_00222718 predicted 971
9 SASI_Hs01_00222719 predicted 317
10 SASI_Hs02_00359355 predicted 352
11 SASI_Hs01_00222720 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243674 predicted 1272
2 SASI_Rn02_00243675 predicted 448
3 SASI_Rn02_00243676 predicted 989
4 SASI_Rn02_00243677 predicted 374
5 SASI_Rn02_00243678 predicted 664
6 SASI_Rn02_00243679 predicted 1184
7 SASI_Rn02_00243680 predicted 752
8 SASI_Rn02_00243681 predicted 1013
9 SASI_Rn02_00243682 predicted 363
10 SASI_Rn02_00243683 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113571 predicted 1001
2 SASI_Mm01_00113572 predicted 974
3 SASI_Mm02_00330360 predicted 350
4 SASI_Mm02_00330361 predicted 924
5 SASI_Mm02_00330362 predicted 1003
6 SASI_Mm01_00113570 predicted 436
7 SASI_Mm01_00113573 predicted 311
8 SASI_Mm01_00113574 predicted 995
9 SASI_Mm01_00113575 predicted 389
10 SASI_Mm01_00113576 predicted 1128
11 SASI_Mm01_00113577 predicted 1236
12 SASI_Mm01_00113578 predicted 1144
13 SASI_Mm01_00113579 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032132
VALIDATED
HORMAD1 MISSION shRNA Bacterial Glycerol Stock
HORMA domain containing 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-694s21c1
Sequence:CCGGTGATTGTGAAGGAGTTATATTCTCGAGAATATAACTCCTTCACAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-217s21c1
Sequence:CCGGAGTATCCTGTATCACGTATTTCTCGAGAAATACGTGATACAGGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-257s21c1
Sequence:CCGGTGCGCTTATGGAACAAGATATCTCGAGATATCTTGTTCCATAAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-525s1c1
Sequence:CCGGGCATGTTGTCTACTGACACCACTCGAGTGGTGTCAGTAGACAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032132.2-1439s1c1
Sequence:CCGGGTGGTCCTTAATCTTGAGATACTCGAGTATCTCAAGATTAAGGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-335s1c1
Sequence:CCGGCAGTTAGTGAAATGGATGCTACTCGAGTAGCATCCATTTCACTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-884s1c1
Sequence:CCGGGAAGATGAACAGGAGCATTATCTCGAGATAATGCTCCTGTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-568s21c1
Sequence:CCGGTCGCAAGATTTATATCCTAATCTCGAGATTAGGATATAAATCTTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1316s1c1
Sequence:CCGGGCAGAGTTCTTCTCACCATTTCTCGAGAAATGGTGAGAAGAACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1363s1c1
Sequence:CCGGCCCTAACTCTGAAGATGTATACTCGAGTATACATCTTCAGAGTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1579s1c1
Sequence:CCGGCTAACTGTTAAGGCCCTCTAACTCGAGTTAGAGGGCCTTAACAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-1055s1c1
Sequence:CCGGGTTGAGCAGTTAGTCAATAAACTCGAGTTTATTGACTAACTGCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-391s21c1
Sequence:CCGGGATGGTTGTTCTAGCTGTATACTCGAGTATACAGCTAGAACAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-419s1c1
Sequence:CCGGCCAGAAGATCCTCAGACAATTCTCGAGAATTGTCTGAGGATCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-980s1c1
Sequence:CCGGCCAAGTTTAGTTTGTGAGGAACTCGAGTTCCTCACAAACTAAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032132
VALIDATED
HORMAD1 MISSION shRNA shRNA Plasmid DNA
HORMA domain containing 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-694s21c1
Sequence:CCGGTGATTGTGAAGGAGTTATATTCTCGAGAATATAACTCCTTCACAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-217s21c1
Sequence:CCGGAGTATCCTGTATCACGTATTTCTCGAGAAATACGTGATACAGGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-257s21c1
Sequence:CCGGTGCGCTTATGGAACAAGATATCTCGAGATATCTTGTTCCATAAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-525s1c1
Sequence:CCGGGCATGTTGTCTACTGACACCACTCGAGTGGTGTCAGTAGACAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032132.2-1439s1c1
Sequence:CCGGGTGGTCCTTAATCTTGAGATACTCGAGTATCTCAAGATTAAGGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-335s1c1
Sequence:CCGGCAGTTAGTGAAATGGATGCTACTCGAGTAGCATCCATTTCACTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-884s1c1
Sequence:CCGGGAAGATGAACAGGAGCATTATCTCGAGATAATGCTCCTGTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-568s21c1
Sequence:CCGGTCGCAAGATTTATATCCTAATCTCGAGATTAGGATATAAATCTTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1316s1c1
Sequence:CCGGGCAGAGTTCTTCTCACCATTTCTCGAGAAATGGTGAGAAGAACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1363s1c1
Sequence:CCGGCCCTAACTCTGAAGATGTATACTCGAGTATACATCTTCAGAGTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1579s1c1
Sequence:CCGGCTAACTGTTAAGGCCCTCTAACTCGAGTTAGAGGGCCTTAACAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-1055s1c1
Sequence:CCGGGTTGAGCAGTTAGTCAATAAACTCGAGTTTATTGACTAACTGCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-391s21c1
Sequence:CCGGGATGGTTGTTCTAGCTGTATACTCGAGTATACAGCTAGAACAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-419s1c1
Sequence:CCGGCCAGAAGATCCTCAGACAATTCTCGAGAATTGTCTGAGGATCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-980s1c1
Sequence:CCGGCCAAGTTTAGTTTGTGAGGAACTCGAGTTCCTCACAAACTAAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032132
VALIDATED
HORMAD1 MISSION shRNA Lentiviral Transduction Particles
HORMA domain containing 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-694s21c1
Sequence:CCGGTGATTGTGAAGGAGTTATATTCTCGAGAATATAACTCCTTCACAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-217s21c1
Sequence:CCGGAGTATCCTGTATCACGTATTTCTCGAGAAATACGTGATACAGGATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-257s21c1
Sequence:CCGGTGCGCTTATGGAACAAGATATCTCGAGATATCTTGTTCCATAAGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-525s1c1
Sequence:CCGGGCATGTTGTCTACTGACACCACTCGAGTGGTGTCAGTAGACAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032132.2-1439s1c1
Sequence:CCGGGTGGTCCTTAATCTTGAGATACTCGAGTATCTCAAGATTAAGGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-335s1c1
Sequence:CCGGCAGTTAGTGAAATGGATGCTACTCGAGTAGCATCCATTTCACTAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-884s1c1
Sequence:CCGGGAAGATGAACAGGAGCATTATCTCGAGATAATGCTCCTGTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-568s21c1
Sequence:CCGGTCGCAAGATTTATATCCTAATCTCGAGATTAGGATATAAATCTTGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1316s1c1
Sequence:CCGGGCAGAGTTCTTCTCACCATTTCTCGAGAAATGGTGAGAAGAACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1363s1c1
Sequence:CCGGCCCTAACTCTGAAGATGTATACTCGAGTATACATCTTCAGAGTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032132.2-1579s1c1
Sequence:CCGGCTAACTGTTAAGGCCCTCTAACTCGAGTTAGAGGGCCTTAACAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-1055s1c1
Sequence:CCGGGTTGAGCAGTTAGTCAATAAACTCGAGTTTATTGACTAACTGCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032132.3-391s21c1
Sequence:CCGGGATGGTTGTTCTAGCTGTATACTCGAGTATACAGCTAGAACAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-419s1c1
Sequence:CCGGCCAGAAGATCCTCAGACAATTCTCGAGAATTGTCTGAGGATCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032132.2-980s1c1
Sequence:CCGGCCAAGTTTAGTTTGTGAGGAACTCGAGTTCCTCACAAACTAAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026489
HORMAD1 MISSION shRNA Bacterial Glycerol Stock
HORMA domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.1-578s1c1
Sequence:CCGGGATGTTTGTCTGACCATGAAACTCGAGTTTCATGGTCAGACAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.1-1138s1c1
Sequence:CCGGGAAGAGAAGTCTTCGTCAATTCTCGAGAATTGACGAAGACTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.2-179s1c1
Sequence:CCGGGTATCTTGCATCACCTATTTGCTCGAGCAAATAGGTGATGCAAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.2-352s1c1
Sequence:CCGGGATGATCATTCTAGCTGTATACTCGAGTATACAGCTAGAATGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-1137s21c1
Sequence:CCGGAGAGAAGTCTTCGTCAATTTACTCGAGTAAATTGACGAAGACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-178s21c1
Sequence:CCGGAGTATCTTGCATCACCTATTTCTCGAGAAATAGGTGATGCAAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-654s21c1
Sequence:CCGGGTGACTGTGAAGGAGTAATATCTCGAGATATTACTCCTTCACAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-128s21c1
Sequence:CCGGTCAACTGAGCATCAATCTTTGCTCGAGCAAAGATTGATGCTCAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026489.2-1199s21c1
Sequence:CCGGTGCCCTGGACTTGGAGTTAAACTCGAGTTTAACTCCAAGTCCAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026489.2-1227s1c1
Sequence:CCGGCACGTCTTGGAATCTAGTCAACTCGAGTTGACTAGATTCCAAGACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026489
HORMAD1 MISSION shRNA shRNA Plasmid DNA
HORMA domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.1-578s1c1
Sequence:CCGGGATGTTTGTCTGACCATGAAACTCGAGTTTCATGGTCAGACAAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.1-1138s1c1
Sequence:CCGGGAAGAGAAGTCTTCGTCAATTCTCGAGAATTGACGAAGACTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.2-179s1c1
Sequence:CCGGGTATCTTGCATCACCTATTTGCTCGAGCAAATAGGTGATGCAAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.2-352s1c1
Sequence:CCGGGATGATCATTCTAGCTGTATACTCGAGTATACAGCTAGAATGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-1137s21c1
Sequence:CCGGAGAGAAGTCTTCGTCAATTTACTCGAGTAAATTGACGAAGACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-178s21c1
Sequence:CCGGAGTATCTTGCATCACCTATTTCTCGAGAAATAGGTGATGCAAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-654s21c1
Sequence:CCGGGTGACTGTGAAGGAGTAATATCTCGAGATATTACTCCTTCACAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-128s21c1
Sequence:CCGGTCAACTGAGCATCAATCTTTGCTCGAGCAAAGATTGATGCTCAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026489.2-1199s21c1
Sequence:CCGGTGCCCTGGACTTGGAGTTAAACTCGAGTTTAACTCCAAGTCCAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026489.2-1227s1c1
Sequence:CCGGCACGTCTTGGAATCTAGTCAACTCGAGTTGACTAGATTCCAAGACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026489
HORMAD1 MISSION shRNA Lentiviral Transduction Particles
HORMA domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.1-578s1c1
Sequence:CCGGGATGTTTGTCTGACCATGAAACTCGAGTTTCATGGTCAGACAAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.1-1138s1c1
Sequence:CCGGGAAGAGAAGTCTTCGTCAATTCTCGAGAATTGACGAAGACTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.2-179s1c1
Sequence:CCGGGTATCTTGCATCACCTATTTGCTCGAGCAAATAGGTGATGCAAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026489.2-352s1c1
Sequence:CCGGGATGATCATTCTAGCTGTATACTCGAGTATACAGCTAGAATGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-1137s21c1
Sequence:CCGGAGAGAAGTCTTCGTCAATTTACTCGAGTAAATTGACGAAGACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-178s21c1
Sequence:CCGGAGTATCTTGCATCACCTATTTCTCGAGAAATAGGTGATGCAAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-654s21c1
Sequence:CCGGGTGACTGTGAAGGAGTAATATCTCGAGATATTACTCCTTCACAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026489.2-128s21c1
Sequence:CCGGTCAACTGAGCATCAATCTTTGCTCGAGCAAAGATTGATGCTCAGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026489.2-1199s21c1
Sequence:CCGGTGCCCTGGACTTGGAGTTAAACTCGAGTTTAACTCCAAGTCCAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026489.2-1227s1c1
Sequence:CCGGCACGTCTTGGAATCTAGTCAACTCGAGTTGACTAGATTCCAAGACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)