EMAIL THIS PAGE TO A FRIEND

HORMAD2

HORMA domain containing 2

147 Gene Product Result for
UniProtKB ID: Q8N7B1, B5MEB2, Q8NHR2
Gene ID:
Mouse(75828) HORMA domain containing 2
Rat(498400) HORMA domain containing 2
chicken(417012) HORMA domain containing 2
cow(777596) HORMA domain containing 2
dog(611903) HORMA domain containing 2
domestic cat(101090051) HORMA domain containing 2
sheep(101109914) HORMA domain containing 2
domestic guinea pig(100724975) HORMA domain containing 2
naked mole-rat(101705124) HORMA domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152510 Rosetta Predictions human pricing
NM_001017501 Rosetta Predictions rat pricing
NM_029458 Rosetta Predictions mouse pricing
XM_973907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128252 predicted 225
2 SASI_Hs01_00128253 predicted 676
3 SASI_Hs01_00128254 predicted 587
4 SASI_Hs01_00128255 predicted 355
5 SASI_Hs01_00128257 predicted 601
6 SASI_Hs01_00128258 predicted 351
7 SASI_Hs01_00128259 predicted 724
8 SASI_Hs02_00366291 predicted 415
9 SASI_Hs01_00128260 predicted 526
10 SASI_Hs02_00366292 predicted 539
11 SASI_Hs01_00128251 predicted 548
12 SASI_Hs01_00128256 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060115 predicted 785
2 SASI_Rn01_00060117 predicted 419
3 SASI_Rn01_00060118 predicted 420
4 SASI_Rn01_00060119 predicted 408
5 SASI_Rn01_00060120 predicted 343
6 SASI_Rn01_00060121 predicted 1126
7 SASI_Rn01_00060122 predicted 774
8 SASI_Rn01_00060123 predicted 706
9 SASI_Rn01_00060124 predicted 365
10 SASI_Rn02_00202324 predicted 949
11 SASI_Rn01_00060116 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335383 predicted 533
2 SASI_Mm02_00335384 predicted 823
3 SASI_Mm02_00335385 predicted 592
4 SASI_Mm02_00335386 predicted 547
5 SASI_Mm02_00335387 predicted 710
6 SASI_Mm02_00335388 predicted 879
7 SASI_Mm02_00335389 predicted 526
8 SASI_Mm02_00335390 predicted 849
9 SASI_Mm02_00335391 predicted 594
10 SASI_Mm02_00335392 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224543 predicted 530
2 SASI_Mm01_00224544 predicted 470
3 SASI_Mm01_00224545 predicted 452
4 SASI_Mm01_00224546 predicted 293
5 SASI_Mm01_00224547 predicted 516
6 SASI_Mm01_00224548 predicted 586
7 SASI_Mm01_00224549 predicted 312
8 SASI_Mm01_00224550 predicted 696
9 SASI_Mm01_00224551 predicted 650
10 SASI_Mm01_00224552 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152510
HORMAD2 MISSION shRNA Bacterial Glycerol Stock
HORMA domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152510.2-295s21c1
Sequence:CCGGGTCCCGGGTCACTGCATATTACTCGAGTAATATGCAGTGACCCGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1452s21c1
Sequence:CCGGGCTTATCCAGGTGTGATTTATCTCGAGATAAATCACACCTGGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1173s21c1
Sequence:CCGGCATAAGGAAAGCGGGTCAATACTCGAGTATTGACCCGCTTTCCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1394s21c1
Sequence:CCGGGAATCCCTCTCTAGCTGTATTCTCGAGAATACAGCTAGAGAGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-912s1c1
Sequence:CCGGGCAGTCAGCAAAGTTCTGAGTCTCGAGACTCAGAACTTTGCTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152510.1-869s1c1
Sequence:CCGGGAAGAAGAATGCAATGACCATCTCGAGATGGTCATTGCATTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-805s1c1
Sequence:CCGGGAACAATCTGTTTCGGGAGAACTCGAGTTCTCCCGAAACAGATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-486s1c1
Sequence:CCGGGCAGCAGTACAAGCTTTGAAACTCGAGTTTCAAAGCTTGTACTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-538s1c1
Sequence:CCGGCAGTGTTCTACTGATCCGTAACTCGAGTTACGGATCAGTAGAACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-700s1c1
Sequence:CCGGGTTTGACAAGGAGCCTATCAACTCGAGTTGATAGGCTCCTTGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152510
HORMAD2 MISSION shRNA shRNA Plasmid DNA
HORMA domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152510.2-295s21c1
Sequence:CCGGGTCCCGGGTCACTGCATATTACTCGAGTAATATGCAGTGACCCGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1452s21c1
Sequence:CCGGGCTTATCCAGGTGTGATTTATCTCGAGATAAATCACACCTGGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1173s21c1
Sequence:CCGGCATAAGGAAAGCGGGTCAATACTCGAGTATTGACCCGCTTTCCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1394s21c1
Sequence:CCGGGAATCCCTCTCTAGCTGTATTCTCGAGAATACAGCTAGAGAGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-912s1c1
Sequence:CCGGGCAGTCAGCAAAGTTCTGAGTCTCGAGACTCAGAACTTTGCTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152510.1-869s1c1
Sequence:CCGGGAAGAAGAATGCAATGACCATCTCGAGATGGTCATTGCATTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-805s1c1
Sequence:CCGGGAACAATCTGTTTCGGGAGAACTCGAGTTCTCCCGAAACAGATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-486s1c1
Sequence:CCGGGCAGCAGTACAAGCTTTGAAACTCGAGTTTCAAAGCTTGTACTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-538s1c1
Sequence:CCGGCAGTGTTCTACTGATCCGTAACTCGAGTTACGGATCAGTAGAACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-700s1c1
Sequence:CCGGGTTTGACAAGGAGCCTATCAACTCGAGTTGATAGGCTCCTTGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152510
HORMAD2 MISSION shRNA Lentiviral Transduction Particles
HORMA domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152510.2-295s21c1
Sequence:CCGGGTCCCGGGTCACTGCATATTACTCGAGTAATATGCAGTGACCCGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1452s21c1
Sequence:CCGGGCTTATCCAGGTGTGATTTATCTCGAGATAAATCACACCTGGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1173s21c1
Sequence:CCGGCATAAGGAAAGCGGGTCAATACTCGAGTATTGACCCGCTTTCCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152510.2-1394s21c1
Sequence:CCGGGAATCCCTCTCTAGCTGTATTCTCGAGAATACAGCTAGAGAGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-912s1c1
Sequence:CCGGGCAGTCAGCAAAGTTCTGAGTCTCGAGACTCAGAACTTTGCTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152510.1-869s1c1
Sequence:CCGGGAAGAAGAATGCAATGACCATCTCGAGATGGTCATTGCATTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-805s1c1
Sequence:CCGGGAACAATCTGTTTCGGGAGAACTCGAGTTCTCCCGAAACAGATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-486s1c1
Sequence:CCGGGCAGCAGTACAAGCTTTGAAACTCGAGTTTCAAAGCTTGTACTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-538s1c1
Sequence:CCGGCAGTGTTCTACTGATCCGTAACTCGAGTTACGGATCAGTAGAACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152510.1-700s1c1
Sequence:CCGGGTTTGACAAGGAGCCTATCAACTCGAGTTGATAGGCTCCTTGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029458
HORMAD2 MISSION shRNA Bacterial Glycerol Stock
HORMA domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-759s21c1
Sequence:CCGGTCCGAATGATGTTATACTTACCTCGAGGTAAGTATAACATCATTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-274s21c1
Sequence:CCGGAGAACACTGAAGGCGTCTAAGCTCGAGCTTAGACGCCTTCAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-534s21c1
Sequence:GTACCGGATACCTACACATGGCAGTATTCTCGAGAATACTGCCATGTGTAGGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-708s21c1
Sequence:CCGGTTCCCTACTAATCCGTCAATTCTCGAGAATTGACGGATTAGTAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-362s21c1
Sequence:CCGGCTACTTGTATCTCATGTATAACTCGAGTTATACATGAGATACAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-304s21c1
Sequence:CCGGTTCCCGTCCCAAGTGACAAATCTCGAGATTTGTCACTTGGGACGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029458.1-1171s21c1
Sequence:CCGGGGTGCCTTTGCTACACCTGTTCTCGAGAACAGGTGTAGCAAAGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029458
HORMAD2 MISSION shRNA shRNA Plasmid DNA
HORMA domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-759s21c1
Sequence:CCGGTCCGAATGATGTTATACTTACCTCGAGGTAAGTATAACATCATTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-274s21c1
Sequence:CCGGAGAACACTGAAGGCGTCTAAGCTCGAGCTTAGACGCCTTCAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-534s21c1
Sequence:GTACCGGATACCTACACATGGCAGTATTCTCGAGAATACTGCCATGTGTAGGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-708s21c1
Sequence:CCGGTTCCCTACTAATCCGTCAATTCTCGAGAATTGACGGATTAGTAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-362s21c1
Sequence:CCGGCTACTTGTATCTCATGTATAACTCGAGTTATACATGAGATACAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-304s21c1
Sequence:CCGGTTCCCGTCCCAAGTGACAAATCTCGAGATTTGTCACTTGGGACGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029458.1-1171s21c1
Sequence:CCGGGGTGCCTTTGCTACACCTGTTCTCGAGAACAGGTGTAGCAAAGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029458
HORMAD2 MISSION shRNA Lentiviral Transduction Particles
HORMA domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-759s21c1
Sequence:CCGGTCCGAATGATGTTATACTTACCTCGAGGTAAGTATAACATCATTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-274s21c1
Sequence:CCGGAGAACACTGAAGGCGTCTAAGCTCGAGCTTAGACGCCTTCAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-534s21c1
Sequence:GTACCGGATACCTACACATGGCAGTATTCTCGAGAATACTGCCATGTGTAGGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-708s21c1
Sequence:CCGGTTCCCTACTAATCCGTCAATTCTCGAGAATTGACGGATTAGTAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-362s21c1
Sequence:CCGGCTACTTGTATCTCATGTATAACTCGAGTTATACATGAGATACAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029458.1-304s21c1
Sequence:CCGGTTCCCGTCCCAAGTGACAAATCTCGAGATTTGTCACTTGGGACGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029458.1-1171s21c1
Sequence:CCGGGGTGCCTTTGCTACACCTGTTCTCGAGAACAGGTGTAGCAAAGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)