EMAIL THIS PAGE TO A FRIEND

HOXA10

homeobox A10

152 Gene Product Result for
Synonyms: HOX1 HOX1.8 HOX1H PL
UniProtKB ID: P31260, O43370, O43605, Q15949, Q504T1
Gene ID:
Human(3206) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor that may regulate gene expression, morphogenesis, and differentiation. More specifically, it may function in fertility, embryo viability, and regulation of hematopoietic lineage commitment. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the downstream homeobox A9 (HOXA9) gene. [provided by RefSeq, Mar 2011]
Mouse(15395) homeobox A10
sheep(101105239) homeobox A10
chicken(776143) homeobox A10
cow(784386) homeobox A10
dog(482373) homeobox A10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018951 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131511 MISSION® esiRNA esiRNA human HOXA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018951 Rosetta Predictions human pricing
NM_153715 Rosetta Predictions human pricing
NM_001122950 Rosetta Predictions mouse pricing
NM_008263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172491 predicted 1379
2 SASI_Hs01_00172492 predicted 1350
3 SASI_Hs01_00172493 predicted 1440
4 SASI_Hs01_00172495 predicted 1231
5 SASI_Hs01_00172496 predicted 1378
6 SASI_Hs01_00172497 predicted 1510
7 SASI_Hs01_00172498 predicted 1501
8 SASI_Hs01_00172499 predicted 1377
9 SASI_Hs01_00172500 predicted 1232
10 SASI_Hs02_00352423 predicted 1447
11 SASI_Hs01_00172494 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104678 predicted 1001
2 SASI_Hs01_00104679 predicted 976
3 SASI_Hs01_00104680 predicted 1062
4 SASI_Hs01_00104682 predicted 852
5 SASI_Hs01_00104683 predicted 999
6 SASI_Hs01_00104684 predicted 1132
7 SASI_Hs01_00104685 predicted 1126
8 SASI_Hs01_00104686 predicted 1002
9 SASI_Hs01_00104687 predicted 855
10 SASI_Hs02_00367443 predicted 1070
11 SASI_Hs01_00104681 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309619 predicted 701
2 SASI_Mm02_00309620 predicted 627
3 SASI_Mm02_00309621 predicted 709
4 SASI_Mm02_00309622 predicted 1339
5 SASI_Mm02_00309623 predicted 1291
6 SASI_Mm02_00309624 predicted 1126
7 SASI_Mm02_00309625 predicted 1125
8 SASI_Mm02_00309626 predicted 1292
9 SASI_Mm02_00309627 predicted 1156
10 SASI_Mm02_00309628 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313481 predicted 34
2 SASI_Mm01_00201151 predicted 1013
3 SASI_Mm02_00313482 predicted 1681
4 SASI_Mm02_00313483 predicted 1518
5 SASI_Mm02_00313484 predicted 664
6 SASI_Mm02_00313485 predicted 1519
7 SASI_Mm02_00313486 predicted 536
8 SASI_Mm02_00313487 predicted 1678
9 SASI_Mm02_00313488 predicted 544
10 SASI_Mm02_00313489 predicted 1539
11 SASI_Mm01_00201150 predicted 1088
12 SASI_Mm01_00201152 predicted 1090
13 SASI_Mm01_00201153 predicted 831
14 SASI_Mm01_00201154 predicted 970
15 SASI_Mm01_00201155 predicted 1024
16 SASI_Mm01_00201156 predicted 1026
17 SASI_Mm01_00201157 predicted 984
18 SASI_Mm01_00201158 predicted 818
19 SASI_Mm01_00201159 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008263
HOXA10 MISSION shRNA Bacterial Glycerol Stock
homeobox A10
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000012513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008263.1-2135s1c1
Sequence:CCGGCCCTATTTAATGGAGGTTGTTCTCGAGAACAACCTCCATTAAATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-541s1c1
Sequence:CCGGTCTACGATGCTGCGGACAAATCTCGAGATTTGTCCGCAGCATCGTAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-1182s1c1
Sequence:CCGGCGCAGGATGAAACTGAAGAAACTCGAGTTTCTTCAGTTTCATCCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-485s1c1
Sequence:CCGGACAGGCCACTTCGTGTTCTTTCTCGAGAAAGAACACGAAGTGGCCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008263
HOXA10 MISSION shRNA shRNA Plasmid DNA
homeobox A10
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000012513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008263.1-2135s1c1
Sequence:CCGGCCCTATTTAATGGAGGTTGTTCTCGAGAACAACCTCCATTAAATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-541s1c1
Sequence:CCGGTCTACGATGCTGCGGACAAATCTCGAGATTTGTCCGCAGCATCGTAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-1182s1c1
Sequence:CCGGCGCAGGATGAAACTGAAGAAACTCGAGTTTCTTCAGTTTCATCCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-485s1c1
Sequence:CCGGACAGGCCACTTCGTGTTCTTTCTCGAGAAAGAACACGAAGTGGCCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008263
HOXA10 MISSION shRNA Lentiviral Transduction Particles
homeobox A10
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000012513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008263.1-2135s1c1
Sequence:CCGGCCCTATTTAATGGAGGTTGTTCTCGAGAACAACCTCCATTAAATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-541s1c1
Sequence:CCGGTCTACGATGCTGCGGACAAATCTCGAGATTTGTCCGCAGCATCGTAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-1182s1c1
Sequence:CCGGCGCAGGATGAAACTGAAGAAACTCGAGTTTCTTCAGTTTCATCCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008263.1-485s1c1
Sequence:CCGGACAGGCCACTTCGTGTTCTTTCTCGAGAAAGAACACGAAGTGGCCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018951
HOXA10 MISSION shRNA Bacterial Glycerol Stock
homeobox A10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018951.2-2113s1c1
Sequence:CCGGCCCTATCTTGTGAAGTTGTTTCTCGAGAAACAACTTCACAAGATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-335s1c1
Sequence:CCGGTCGCCCATAGACCTGTGGCTACTCGAGTAGCCACAGGTCTATGGGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-1121s1c1
Sequence:CCGGCTCACGGACAGACAAGTGAAACTCGAGTTTCACTTGTCTGTCCGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-991s1c1
Sequence:CCGGCACGGCAAAGAGTGGTCGGAACTCGAGTTCCGACCACTCTTTGCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-475s1c1
Sequence:CCGGCGCGCAGAACATCAAAGAAGACTCGAGTCTTCTTTGATGTTCTGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018951
HOXA10 MISSION shRNA shRNA Plasmid DNA
homeobox A10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018951.2-2113s1c1
Sequence:CCGGCCCTATCTTGTGAAGTTGTTTCTCGAGAAACAACTTCACAAGATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-335s1c1
Sequence:CCGGTCGCCCATAGACCTGTGGCTACTCGAGTAGCCACAGGTCTATGGGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-1121s1c1
Sequence:CCGGCTCACGGACAGACAAGTGAAACTCGAGTTTCACTTGTCTGTCCGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-991s1c1
Sequence:CCGGCACGGCAAAGAGTGGTCGGAACTCGAGTTCCGACCACTCTTTGCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-475s1c1
Sequence:CCGGCGCGCAGAACATCAAAGAAGACTCGAGTCTTCTTTGATGTTCTGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018951
HOXA10 MISSION shRNA Lentiviral Transduction Particles
homeobox A10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018951.2-2113s1c1
Sequence:CCGGCCCTATCTTGTGAAGTTGTTTCTCGAGAAACAACTTCACAAGATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-335s1c1
Sequence:CCGGTCGCCCATAGACCTGTGGCTACTCGAGTAGCCACAGGTCTATGGGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-1121s1c1
Sequence:CCGGCTCACGGACAGACAAGTGAAACTCGAGTTTCACTTGTCTGTCCGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-991s1c1
Sequence:CCGGCACGGCAAAGAGTGGTCGGAACTCGAGTTCCGACCACTCTTTGCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018951.2-475s1c1
Sequence:CCGGCGCGCAGAACATCAAAGAAGACTCGAGTCTTCTTTGATGTTCTGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)