EMAIL THIS PAGE TO A FRIEND

HOXA11

homeobox A11

125 Gene Product Result for
Synonyms: HOX1 HOX1I
UniProtKB ID: P31270, A4D190
Gene ID:
Human(3207) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. This gene is involved in the regulation of uterine development and is required for female fertility. Mutations in this gene can cause radio-ulnar synostosis with amegakaryocytic thrombocytopenia. [provided by RefSeq, Jul 2008]
Mouse(15396) homeobox A11
Rat(368057) homeobox A11
chicken(395327) homeobox A11
dog(100683897) homeobox A11
cow(100336578) homeobox A11
sheep(101114267) homeobox A11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107319 Anti-HOXA10 antibody produced in rabbit affinity isolated antibody rabbit, human, rat, sheep, guinea pig, horse
ELISA, western blot pricing
AV37064 Anti-HOXA11 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, horse, rat, rabbit, bovine, human
immunohistochemistry, western blot pricing
SAB2101062 Anti-HOXA11 antibody produced in rabbit affinity isolated antibody bovine, rabbit, canine, mouse, horse, human, rabbit, rat
western blot pricing
HPA035623 Anti-HOXA11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4501429 Anti-HOXA11 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1410649 Anti-HOXA11 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA006770 Anti-HOXA11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1304728 ANTI-MOUSE HOXA11 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
WH0003207M1 Monoclonal Anti-HOXA11 antibody produced in mouse clone 7E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403933 Monoclonal Anti-HOXA11 antibody produced in mouse clone 8B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409199 Monoclonal Anti-HOXA11 antibody produced in mouse clone 5A3, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, western blot pricing
SAB1409200 Monoclonal Anti-HOXA11 antibody produced in mouse clone 7F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005523 Rosetta Predictions human pricing
NM_001129878 Rosetta Predictions rat pricing
XM_001059439 Rosetta Predictions rat pricing
XM_347220 Rosetta Predictions rat pricing
NM_010450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110410 predicted 1218
2 SASI_Hs01_00110411 predicted 235
3 SASI_Hs01_00110412 predicted 1183
4 SASI_Hs01_00110413 predicted 1478
5 SASI_Hs01_00110414 predicted 1507
6 SASI_Hs01_00110415 predicted 296
7 SASI_Hs01_00110416 predicted 261
8 SASI_Hs01_00110417 predicted 738
9 SASI_Hs01_00110418 predicted 1085
10 SASI_Hs01_00110419 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255209 predicted 1482
2 SASI_Rn02_00255210 predicted 219
3 SASI_Rn02_00255211 predicted 272
4 SASI_Rn02_00255212 predicted 243
5 SASI_Rn02_00255213 predicted 239
6 SASI_Rn02_00255214 predicted 955
7 SASI_Rn02_00255215 predicted 966
8 SASI_Rn02_00255216 predicted 819
9 SASI_Rn02_00255217 predicted 1145
10 SASI_Rn02_00255218 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293187 predicted 876
2 SASI_Rn02_00293188 predicted 958
3 SASI_Rn02_00293189 predicted 911
4 SASI_Rn02_00293190 predicted 891
5 SASI_Rn02_00293191 predicted 1584
6 SASI_Rn02_00293192 predicted 1578
7 SASI_Rn02_00293193 predicted 1530
8 SASI_Rn02_00293194 predicted 1479
9 SASI_Rn02_00293195 predicted 1479
10 SASI_Rn02_00293196 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399596 predicted 2041
2 SASI_Rn02_00399597 predicted 1253
3 SASI_Rn02_00399598 predicted 2229
4 SASI_Rn02_00399599 predicted 2259
5 SASI_Rn02_00399600 predicted 2884
6 SASI_Rn02_00399601 predicted 369
7 SASI_Rn02_00399602 predicted 481
8 SASI_Rn02_00399603 predicted 537
9 SASI_Rn02_00399604 predicted 505
10 SASI_Rn02_00399605 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184302 predicted 955
2 SASI_Mm02_00318621 predicted 964
3 SASI_Mm01_00184303 predicted 946
4 SASI_Mm02_00318622 predicted 1173
5 SASI_Mm02_00318623 predicted 1488
6 SASI_Mm02_00318624 predicted 1181
7 SASI_Mm01_00184307 predicted 279
8 SASI_Mm01_00184308 predicted 938
9 SASI_Mm01_00184309 predicted 242
10 SASI_Mm01_00184311 predicted 874
11 SASI_Mm01_00184304 predicted 1192
12 SASI_Mm01_00184305 predicted 1213
13 SASI_Mm01_00184306 predicted 1185
14 SASI_Mm01_00184310 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005523
VALIDATED
HOXA11 MISSION shRNA Bacterial Glycerol Stock
homeobox A11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-2042s1c1
Sequence:CCGGCCTGAGAGTGAGGTGGAATTACTCGAGTAATTCCACCTCACTCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-187s1c1
Sequence:CCGGGCGCCCAATGACATACTCCTACTCGAGTAGGAGTATGTCATTGGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005523.4-988s1c1
Sequence:CCGGCTCAGCAAATCCACTCCTCTACTCGAGTAGAGGAGTGGATTTGCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-855s1c1
Sequence:CCGGGCGTCTACATTAACAAAGAGACTCGAGTCTCTTTGTTAATGTAGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005523.4-427s1c1
Sequence:CCGGCGCAGTCTCGTCCAATTTCTACTCGAGTAGAAATTGGACGAGACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005523.5-2047s21c1
Sequence:CCGGCCTGAGAGTGAGGTGGAATTACTCGAGTAATTCCACCTCACTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-96s21c1
Sequence:CCGGCTGCTCCTCTAACATGTATTTCTCGAGAAATACATGTTAGAGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-254s21c1
Sequence:CCGGCCTTCAGAGAGTACGCCATTGCTCGAGCAATGGCGTACTCTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-132s21c1
Sequence:CCGGCTACGTCTCGGGTCCAGATTTCTCGAGAAATCTGGACCCGAGACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005523.5-481s21c1
Sequence:CCGGCCACAGGCTTTCGACCAGTTTCTCGAGAAACTGGTCGAAAGCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005523
VALIDATED
HOXA11 MISSION shRNA shRNA Plasmid DNA
homeobox A11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-2042s1c1
Sequence:CCGGCCTGAGAGTGAGGTGGAATTACTCGAGTAATTCCACCTCACTCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-187s1c1
Sequence:CCGGGCGCCCAATGACATACTCCTACTCGAGTAGGAGTATGTCATTGGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005523.4-988s1c1
Sequence:CCGGCTCAGCAAATCCACTCCTCTACTCGAGTAGAGGAGTGGATTTGCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-855s1c1
Sequence:CCGGGCGTCTACATTAACAAAGAGACTCGAGTCTCTTTGTTAATGTAGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005523.4-427s1c1
Sequence:CCGGCGCAGTCTCGTCCAATTTCTACTCGAGTAGAAATTGGACGAGACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005523.5-2047s21c1
Sequence:CCGGCCTGAGAGTGAGGTGGAATTACTCGAGTAATTCCACCTCACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-96s21c1
Sequence:CCGGCTGCTCCTCTAACATGTATTTCTCGAGAAATACATGTTAGAGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-254s21c1
Sequence:CCGGCCTTCAGAGAGTACGCCATTGCTCGAGCAATGGCGTACTCTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-132s21c1
Sequence:CCGGCTACGTCTCGGGTCCAGATTTCTCGAGAAATCTGGACCCGAGACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005523.5-481s21c1
Sequence:CCGGCCACAGGCTTTCGACCAGTTTCTCGAGAAACTGGTCGAAAGCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005523
VALIDATED
HOXA11 MISSION shRNA Lentiviral Transduction Particles
homeobox A11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-2042s1c1
Sequence:CCGGCCTGAGAGTGAGGTGGAATTACTCGAGTAATTCCACCTCACTCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-187s1c1
Sequence:CCGGGCGCCCAATGACATACTCCTACTCGAGTAGGAGTATGTCATTGGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005523.4-988s1c1
Sequence:CCGGCTCAGCAAATCCACTCCTCTACTCGAGTAGAGGAGTGGATTTGCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005523.4-855s1c1
Sequence:CCGGGCGTCTACATTAACAAAGAGACTCGAGTCTCTTTGTTAATGTAGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005523.4-427s1c1
Sequence:CCGGCGCAGTCTCGTCCAATTTCTACTCGAGTAGAAATTGGACGAGACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005523.5-2047s21c1
Sequence:CCGGCCTGAGAGTGAGGTGGAATTACTCGAGTAATTCCACCTCACTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-96s21c1
Sequence:CCGGCTGCTCCTCTAACATGTATTTCTCGAGAAATACATGTTAGAGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-254s21c1
Sequence:CCGGCCTTCAGAGAGTACGCCATTGCTCGAGCAATGGCGTACTCTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005523.5-132s21c1
Sequence:CCGGCTACGTCTCGGGTCCAGATTTCTCGAGAAATCTGGACCCGAGACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005523.5-481s21c1
Sequence:CCGGCCACAGGCTTTCGACCAGTTTCTCGAGAAACTGGTCGAAAGCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010450
VALIDATED
HOXA11 MISSION shRNA Bacterial Glycerol Stock
homeobox A11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-786s1c1
Sequence:CCGGCCCTTATACCAAATACCAGATCTCGAGATCTGGTATTTGGTATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-969s1c1
Sequence:CCGGCTCAGCTAATCCACTTCTCTACTCGAGTAGAGAAGTGGATTAGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010450.1-75s1c1
Sequence:CCGGCTGCTCCTCTAACATGTATTTCTCGAGAAATACATGTTAGAGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-460s1c1
Sequence:CCGGCCACAGGCTTTCGACCAGTTTCTCGAGAAACTGGTCGAAAGCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-780s1c1
Sequence:CCGGGCGCTGCCCTTATACCAAATACTCGAGTATTTGGTATAAGGGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-833s21c1
Sequence:CCGGTCAGCGTCTACATCAACAAAGCTCGAGCTTTGTTGATGTAGACGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-281s21c1
Sequence:CCGGGCAATCTGGCCCACTGCTACTCTCGAGAGTAGCAGTGGGCCAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-228s21c1
Sequence:CCGGAGTGACCTTCAGAGAGTACGCCTCGAGGCGTACTCTCTGAAGGTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010450.2-1182s21c1
Sequence:CCGGGTTAAGCTTCCTATTAGTAATCTCGAGATTACTAATAGGAAGCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010450
VALIDATED
HOXA11 MISSION shRNA shRNA Plasmid DNA
homeobox A11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-786s1c1
Sequence:CCGGCCCTTATACCAAATACCAGATCTCGAGATCTGGTATTTGGTATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-969s1c1
Sequence:CCGGCTCAGCTAATCCACTTCTCTACTCGAGTAGAGAAGTGGATTAGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010450.1-75s1c1
Sequence:CCGGCTGCTCCTCTAACATGTATTTCTCGAGAAATACATGTTAGAGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-460s1c1
Sequence:CCGGCCACAGGCTTTCGACCAGTTTCTCGAGAAACTGGTCGAAAGCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-780s1c1
Sequence:CCGGGCGCTGCCCTTATACCAAATACTCGAGTATTTGGTATAAGGGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-833s21c1
Sequence:CCGGTCAGCGTCTACATCAACAAAGCTCGAGCTTTGTTGATGTAGACGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-281s21c1
Sequence:CCGGGCAATCTGGCCCACTGCTACTCTCGAGAGTAGCAGTGGGCCAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-228s21c1
Sequence:CCGGAGTGACCTTCAGAGAGTACGCCTCGAGGCGTACTCTCTGAAGGTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010450.2-1182s21c1
Sequence:CCGGGTTAAGCTTCCTATTAGTAATCTCGAGATTACTAATAGGAAGCTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010450
VALIDATED
HOXA11 MISSION shRNA Lentiviral Transduction Particles
homeobox A11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-786s1c1
Sequence:CCGGCCCTTATACCAAATACCAGATCTCGAGATCTGGTATTTGGTATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-969s1c1
Sequence:CCGGCTCAGCTAATCCACTTCTCTACTCGAGTAGAGAAGTGGATTAGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010450.1-75s1c1
Sequence:CCGGCTGCTCCTCTAACATGTATTTCTCGAGAAATACATGTTAGAGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-460s1c1
Sequence:CCGGCCACAGGCTTTCGACCAGTTTCTCGAGAAACTGGTCGAAAGCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010450.1-780s1c1
Sequence:CCGGGCGCTGCCCTTATACCAAATACTCGAGTATTTGGTATAAGGGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-833s21c1
Sequence:CCGGTCAGCGTCTACATCAACAAAGCTCGAGCTTTGTTGATGTAGACGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-281s21c1
Sequence:CCGGGCAATCTGGCCCACTGCTACTCTCGAGAGTAGCAGTGGGCCAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010450.2-228s21c1
Sequence:CCGGAGTGACCTTCAGAGAGTACGCCTCGAGGCGTACTCTCTGAAGGTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010450.2-1182s21c1
Sequence:CCGGGTTAAGCTTCCTATTAGTAATCTCGAGATTACTAATAGGAAGCTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)