EMAIL THIS PAGE TO A FRIEND

HOXA13

homeobox A13

103 Gene Product Result for
Synonyms: HOX1 HOX1J
UniProtKB ID: P31271, A4D188, O43371
Gene ID:
Human(3209) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
Mouse(15398) homeobox A13
Rat(500129) homeo box A13
sheep(101114012) homeobox A13
chicken(373934) homeobox A13
dog(482375) homeobox A13
cow(787194) homeobox A13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000522 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047861 MISSION® esiRNA esiRNA human HOXA13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000522 Rosetta Predictions human pricing
XM_575481 Rosetta Predictions rat pricing
XR_007751 Rosetta Predictions rat pricing
NM_008264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094288 predicted 1081
2 SASI_Hs01_00094289 predicted 1431
3 SASI_Hs01_00094290 predicted 1009
4 SASI_Hs01_00094291 predicted 995
5 SASI_Hs01_00094292 predicted 1218
6 SASI_Hs02_00302716 predicted 1246
7 SASI_Hs01_00094294 predicted 1041
8 SASI_Hs01_00094295 predicted 1472
9 SASI_Hs01_00094296 predicted 1559
10 SASI_Hs01_00094297 predicted 1486
11 SASI_Hs01_00094293 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403722 predicted 1105
2 SASI_Rn02_00403723 predicted 611
3 SASI_Rn02_00403724 predicted 909
4 SASI_Rn02_00403725 predicted 1297
5 SASI_Rn02_00403726 predicted 1079
6 SASI_Rn02_00403727 predicted 1287
7 SASI_Rn02_00403728 predicted 1074
8 SASI_Rn02_00403729 predicted 1243
9 SASI_Rn02_00403730 predicted 1155
10 SASI_Rn02_00403731 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415386 predicted 549
2 SASI_Rn01_00138522 predicted 661
3 SASI_Rn01_00138523 predicted 588
4 SASI_Rn01_00138524 predicted 592
5 SASI_Rn02_00415387 predicted 386
6 SASI_Rn01_00138525 predicted 657
7 SASI_Rn01_00138526 predicted 566
8 SASI_Rn01_00138528 predicted 636
9 SASI_Rn01_00138529 predicted 231
10 SASI_Rn01_00138530 predicted 562
11 SASI_Rn01_00138527 predicted 670
12 SASI_Rn01_00138531 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313490 predicted 947
2 SASI_Mm02_00313491 predicted 771
3 SASI_Mm01_00114930 predicted 1016
4 SASI_Mm01_00114931 predicted 774
5 SASI_Mm01_00114932 predicted 1073
6 SASI_Mm01_00114933 predicted 1063
7 SASI_Mm01_00114934 predicted 769
8 SASI_Mm01_00114935 predicted 1082
9 SASI_Mm01_00114936 predicted 705
10 SASI_Mm01_00114937 predicted 1081
11 SASI_Mm01_00114938 predicted 778
12 SASI_Mm01_00114939 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008264
HOXA13 MISSION shRNA Bacterial Glycerol Stock
homeobox A13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008264.1-846s21c1
Sequence:CCGGACCTGGATATGCCAGTAGTTCCTCGAGGAACTACTGGCATATCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008264.1-1148s21c1
Sequence:CCGGGACAAACGGAGGAGGATATCACTCGAGTGATATCCTCCTCCGTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-1081s1c1
Sequence:CCGGGCCTTACACTAAGGTGCAGTTCTCGAGAACTGCACCTTAGTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-151s1c1
Sequence:CCGGCGTCATGTTTCTCTACGACAACTCGAGTTGTCGTAGAGAAACATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-772s1c1
Sequence:CCGGCGCCAAGGAGTTTGCTTTCTACTCGAGTAGAAAGCAAACTCCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-190s1c1
Sequence:CCGGCGACGAGCTCAACAAGAACATCTCGAGATGTTCTTGTTGAGCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-1115s1c1
Sequence:CCGGCGGGAATACGCTACGAACAAACTCGAGTTTGTTCGTAGCGTATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008264
HOXA13 MISSION shRNA shRNA Plasmid DNA
homeobox A13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008264.1-846s21c1
Sequence:CCGGACCTGGATATGCCAGTAGTTCCTCGAGGAACTACTGGCATATCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008264.1-1148s21c1
Sequence:CCGGGACAAACGGAGGAGGATATCACTCGAGTGATATCCTCCTCCGTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-1081s1c1
Sequence:CCGGGCCTTACACTAAGGTGCAGTTCTCGAGAACTGCACCTTAGTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-151s1c1
Sequence:CCGGCGTCATGTTTCTCTACGACAACTCGAGTTGTCGTAGAGAAACATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-772s1c1
Sequence:CCGGCGCCAAGGAGTTTGCTTTCTACTCGAGTAGAAAGCAAACTCCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-190s1c1
Sequence:CCGGCGACGAGCTCAACAAGAACATCTCGAGATGTTCTTGTTGAGCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-1115s1c1
Sequence:CCGGCGGGAATACGCTACGAACAAACTCGAGTTTGTTCGTAGCGTATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008264
HOXA13 MISSION shRNA Lentiviral Transduction Particles
homeobox A13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008264.1-846s21c1
Sequence:CCGGACCTGGATATGCCAGTAGTTCCTCGAGGAACTACTGGCATATCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008264.1-1148s21c1
Sequence:CCGGGACAAACGGAGGAGGATATCACTCGAGTGATATCCTCCTCCGTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-1081s1c1
Sequence:CCGGGCCTTACACTAAGGTGCAGTTCTCGAGAACTGCACCTTAGTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-151s1c1
Sequence:CCGGCGTCATGTTTCTCTACGACAACTCGAGTTGTCGTAGAGAAACATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-772s1c1
Sequence:CCGGCGCCAAGGAGTTTGCTTTCTACTCGAGTAGAAAGCAAACTCCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-190s1c1
Sequence:CCGGCGACGAGCTCAACAAGAACATCTCGAGATGTTCTTGTTGAGCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008264.1-1115s1c1
Sequence:CCGGCGGGAATACGCTACGAACAAACTCGAGTTTGTTCGTAGCGTATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000522
VALIDATED
HOXA13 MISSION shRNA Bacterial Glycerol Stock
homeobox A13
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000015406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-1107s1c1
Sequence:CCGGGTTCCAGAACAGGAGGGTTAACTCGAGTTAACCCTCCTGTTCTGGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-617s1c1
Sequence:CCGGTCGCGGACAAGTACATGGATACTCGAGTATCCATGTACTTGTCCGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-44s1c1
Sequence:CCGGCCGTCATGTTTCTCTACGACACTCGAGTGTCGTAGAGAAACATGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000522
VALIDATED
HOXA13 MISSION shRNA shRNA Plasmid DNA
homeobox A13
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000015406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-1107s1c1
Sequence:CCGGGTTCCAGAACAGGAGGGTTAACTCGAGTTAACCCTCCTGTTCTGGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-617s1c1
Sequence:CCGGTCGCGGACAAGTACATGGATACTCGAGTATCCATGTACTTGTCCGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-44s1c1
Sequence:CCGGCCGTCATGTTTCTCTACGACACTCGAGTGTCGTAGAGAAACATGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000522
VALIDATED
HOXA13 MISSION shRNA Lentiviral Transduction Particles
homeobox A13
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000015406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-1107s1c1
Sequence:CCGGGTTCCAGAACAGGAGGGTTAACTCGAGTTAACCCTCCTGTTCTGGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-617s1c1
Sequence:CCGGTCGCGGACAAGTACATGGATACTCGAGTATCCATGTACTTGTCCGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000522.2-44s1c1
Sequence:CCGGCCGTCATGTTTCTCTACGACACTCGAGTGTCGTAGAGAAACATGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)