EMAIL THIS PAGE TO A FRIEND

HOXA1

homeobox A1

184 Gene Product Result for
Synonyms: BSAS HOX1 HOX1F
UniProtKB ID: P49639, A4D184, B2R8U7, O43363
Gene ID:
Human(3198) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. The encoded protein may be involved in the placement of hindbrain segments in the proper location along the anterior-posterior axis during development. Two transcript variants encoding two different isoforms have been found for this gene, with only one of the isoforms containing the homeodomain region. [provided by RefSeq, Jul 2008]
Mouse(15394) homeobox A1
Rat(25607) homeo box A1
chicken(374051) homeobox A1
dog(482367) homeobox A1
cow(537889) homeobox A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005522 Rosetta Predictions human pricing
NM_153620 Rosetta Predictions human pricing
NM_013075 Rosetta Predictions rat pricing
NM_010449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339739 predicted 1373
2 SASI_Hs01_00043401 predicted 1155
3 SASI_Hs01_00043402 predicted 1596
4 SASI_Hs01_00043403 predicted 1535
5 SASI_Hs01_00043404 predicted 1115
6 SASI_Hs01_00043406 predicted 1556
7 SASI_Hs02_00339740 predicted 1329
8 SASI_Hs01_00043407 predicted 1301
9 SASI_Hs01_00043408 predicted 1532
10 SASI_Hs01_00043409 predicted 1278
11 SASI_Hs01_00043400 predicted 1563
12 SASI_Hs01_00043405 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203441 predicted 906
2 SASI_Hs02_00367368 predicted 747
3 SASI_Hs01_00203442 predicted 956
4 SASI_Hs01_00203443 predicted 953
5 SASI_Hs01_00203444 predicted 556
6 SASI_Hs01_00203446 predicted 422
7 SASI_Hs01_00203447 predicted 360
8 SASI_Hs01_00203448 predicted 349
9 SASI_Hs01_00203449 predicted 106
10 SASI_Hs02_00367369 predicted 359
11 SASI_Hs01_00203445 predicted 380
12 SASI_Hs01_00203450 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110702 predicted 616
2 SASI_Rn01_00110703 predicted 749
3 SASI_Rn01_00110706 predicted 526
4 SASI_Rn02_00260829 predicted 527
5 SASI_Rn01_00110707 predicted 283
6 SASI_Rn02_00260830 predicted 616
7 SASI_Rn01_00110708 predicted 851
8 SASI_Rn01_00110709 predicted 292
9 SASI_Rn01_00110710 predicted 675
10 SASI_Rn02_00260831 predicted 478
11 SASI_Rn01_00110704 predicted 617
12 SASI_Rn01_00110705 predicted 300
13 SASI_Rn01_00110711 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058860 predicted 708
2 SASI_Mm01_00058861 predicted 1157
3 SASI_Mm01_00058862 predicted 1601
4 SASI_Mm01_00058863 predicted 834
5 SASI_Mm01_00058864 predicted 1484
6 SASI_Mm02_00318619 predicted 1169
7 SASI_Mm01_00058866 predicted 616
8 SASI_Mm01_00058868 predicted 1571
9 SASI_Mm01_00058869 predicted 1335
10 SASI_Mm02_00318620 predicted 1019
11 SASI_Mm01_00058865 predicted 1264
12 SASI_Mm01_00058867 predicted 1409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005522
VALIDATED
HOXA1 MISSION shRNA Bacterial Glycerol Stock
homeobox A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005522.3-1866s1c1
Sequence:CCGGGCTGGGTTATTCAGAACCTAACTCGAGTTAGGTTCTGAATAACCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-445s1c1
Sequence:CCGGCCCGCTGTTTACTCTGGAAATCTCGAGATTTCCAGAGTAAACAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-535s1c1
Sequence:CCGGCAATACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-149s1c1
Sequence:CCGGCCTCGGACCATAGGATTACAACTCGAGTTGTAATCCTATGGTCCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-477s21c1
Sequence:CCGGCCGCTGTTTACTCTGGAAATCCTCGAGGATTTCCAGAGTAAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-605s21c1
Sequence:CCGGCTGGCCCTGGCTACGTATAATCTCGAGATTATACGTAGCCAGGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005522.4-1950s21c1
Sequence:CCGGAGTTATCTTAGCTGGATATAACTCGAGTTATATCCAGCTAAGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-566s21c1
Sequence:CCGGCAATACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005522.4-179s21c1
Sequence:CCGGCCCTCGGACCATAGGATTACACTCGAGTGTAATCCTATGGTCCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005522
VALIDATED
HOXA1 MISSION shRNA shRNA Plasmid DNA
homeobox A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005522.3-1866s1c1
Sequence:CCGGGCTGGGTTATTCAGAACCTAACTCGAGTTAGGTTCTGAATAACCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-445s1c1
Sequence:CCGGCCCGCTGTTTACTCTGGAAATCTCGAGATTTCCAGAGTAAACAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-535s1c1
Sequence:CCGGCAATACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-149s1c1
Sequence:CCGGCCTCGGACCATAGGATTACAACTCGAGTTGTAATCCTATGGTCCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-477s21c1
Sequence:CCGGCCGCTGTTTACTCTGGAAATCCTCGAGGATTTCCAGAGTAAACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-605s21c1
Sequence:CCGGCTGGCCCTGGCTACGTATAATCTCGAGATTATACGTAGCCAGGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005522.4-1950s21c1
Sequence:CCGGAGTTATCTTAGCTGGATATAACTCGAGTTATATCCAGCTAAGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-566s21c1
Sequence:CCGGCAATACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005522.4-179s21c1
Sequence:CCGGCCCTCGGACCATAGGATTACACTCGAGTGTAATCCTATGGTCCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005522
VALIDATED
HOXA1 MISSION shRNA Lentiviral Transduction Particles
homeobox A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005522.3-1866s1c1
Sequence:CCGGGCTGGGTTATTCAGAACCTAACTCGAGTTAGGTTCTGAATAACCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-445s1c1
Sequence:CCGGCCCGCTGTTTACTCTGGAAATCTCGAGATTTCCAGAGTAAACAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-535s1c1
Sequence:CCGGCAATACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005522.3-149s1c1
Sequence:CCGGCCTCGGACCATAGGATTACAACTCGAGTTGTAATCCTATGGTCCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-477s21c1
Sequence:CCGGCCGCTGTTTACTCTGGAAATCCTCGAGGATTTCCAGAGTAAACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-605s21c1
Sequence:CCGGCTGGCCCTGGCTACGTATAATCTCGAGATTATACGTAGCCAGGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005522.4-1950s21c1
Sequence:CCGGAGTTATCTTAGCTGGATATAACTCGAGTTATATCCAGCTAAGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005522.4-566s21c1
Sequence:CCGGCAATACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005522.4-179s21c1
Sequence:CCGGCCCTCGGACCATAGGATTACACTCGAGTGTAATCCTATGGTCCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010449
VALIDATED
HOXA1 MISSION shRNA Bacterial Glycerol Stock
homeobox A1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-588s1c1
Sequence:CCGGGCCACGTATAATAACTCCTTACTCGAGTAAGGAGTTATTATACGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010449.1-988s1c1
Sequence:CCGGCGGAAGAATCATCTGAGAAATCTCGAGATTTCTCAGATGATTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-396s1c1
Sequence:CCGGCCCTATGGATTAAATCAGGAACTCGAGTTCCTGATTTAATCCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-151s1c1
Sequence:CCGGCCTCTGACCATGGGATTACAACTCGAGTTGTAATCCCATGGTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-539s1c1
Sequence:CCGGCCAGTACATTCACCACTCATACTCGAGTATGAGTGGTGAATGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-611s21c1
Sequence:CCGGTGGCCCTGGCCACGTATAATACTCGAGTATTATACGTGGCCAGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-403s21c1
Sequence:CCGGCAGAACTTCAGTGCGCCTTATCTCGAGATAAGGCGCACTGAAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-786s21c1
Sequence:CCGGCAACGCAGTGCGCACCAATTTCTCGAGAAATTGGTGCGCACTGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010449.4-1237s21c1
Sequence:CCGGCCTGGCCAAGATAAGGTATTTCTCGAGAAATACCTTATCTTGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-571s21c1
Sequence:CCGGCAGTACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010449
VALIDATED
HOXA1 MISSION shRNA shRNA Plasmid DNA
homeobox A1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-588s1c1
Sequence:CCGGGCCACGTATAATAACTCCTTACTCGAGTAAGGAGTTATTATACGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010449.1-988s1c1
Sequence:CCGGCGGAAGAATCATCTGAGAAATCTCGAGATTTCTCAGATGATTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-396s1c1
Sequence:CCGGCCCTATGGATTAAATCAGGAACTCGAGTTCCTGATTTAATCCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-151s1c1
Sequence:CCGGCCTCTGACCATGGGATTACAACTCGAGTTGTAATCCCATGGTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-539s1c1
Sequence:CCGGCCAGTACATTCACCACTCATACTCGAGTATGAGTGGTGAATGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-611s21c1
Sequence:CCGGTGGCCCTGGCCACGTATAATACTCGAGTATTATACGTGGCCAGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-403s21c1
Sequence:CCGGCAGAACTTCAGTGCGCCTTATCTCGAGATAAGGCGCACTGAAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-786s21c1
Sequence:CCGGCAACGCAGTGCGCACCAATTTCTCGAGAAATTGGTGCGCACTGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010449.4-1237s21c1
Sequence:CCGGCCTGGCCAAGATAAGGTATTTCTCGAGAAATACCTTATCTTGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-571s21c1
Sequence:CCGGCAGTACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010449
VALIDATED
HOXA1 MISSION shRNA Lentiviral Transduction Particles
homeobox A1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-588s1c1
Sequence:CCGGGCCACGTATAATAACTCCTTACTCGAGTAAGGAGTTATTATACGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010449.1-988s1c1
Sequence:CCGGCGGAAGAATCATCTGAGAAATCTCGAGATTTCTCAGATGATTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-396s1c1
Sequence:CCGGCCCTATGGATTAAATCAGGAACTCGAGTTCCTGATTTAATCCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-151s1c1
Sequence:CCGGCCTCTGACCATGGGATTACAACTCGAGTTGTAATCCCATGGTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010449.1-539s1c1
Sequence:CCGGCCAGTACATTCACCACTCATACTCGAGTATGAGTGGTGAATGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-611s21c1
Sequence:CCGGTGGCCCTGGCCACGTATAATACTCGAGTATTATACGTGGCCAGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-403s21c1
Sequence:CCGGCAGAACTTCAGTGCGCCTTATCTCGAGATAAGGCGCACTGAAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-786s21c1
Sequence:CCGGCAACGCAGTGCGCACCAATTTCTCGAGAAATTGGTGCGCACTGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010449.4-1237s21c1
Sequence:CCGGCCTGGCCAAGATAAGGTATTTCTCGAGAAATACCTTATCTTGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010449.4-571s21c1
Sequence:CCGGCAGTACATTCACCACTCATATCTCGAGATATGAGTGGTGAATGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)