EMAIL THIS PAGE TO A FRIEND

HOXA2

homeobox A2

70 Gene Product Result for
Synonyms: HOX1K
UniProtKB ID: O43364, A1L4K3, B2RMW3
Gene ID:
Human(3199) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. The encoded protein may be involved in the placement of hindbrain segments in the proper location along the anterior-posterior axis during development. [provided by RefSeq, Jul 2008]
Mouse(15399) homeobox A2
Rat(24452) homeo box A2
chicken(396055) homeobox A2
dog(609592) homeobox A2
cow(524150) homeobox A2
sheep(101106161) homeobox A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038871 MISSION® esiRNA esiRNA human HOXA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006735 Rosetta Predictions human pricing
NM_012581 Rosetta Predictions rat pricing
NM_010451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237016 predicted 1440
2 SASI_Hs01_00237017 predicted 1147
3 SASI_Hs01_00237018 predicted 1096
4 SASI_Hs01_00237019 predicted 960
5 SASI_Hs01_00237020 predicted 1325
6 SASI_Hs01_00237021 predicted 1146
7 SASI_Hs02_00342180 predicted 913
8 SASI_Hs01_00237022 predicted 1511
9 SASI_Hs01_00237023 predicted 1540
10 SASI_Hs01_00237025 predicted 1179
11 SASI_Hs01_00237024 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096683 predicted 967
2 SASI_Rn02_00259715 predicted 682
3 SASI_Rn01_00096685 predicted 574
4 SASI_Rn01_00096686 predicted 1100
5 SASI_Rn02_00259716 predicted 1359
6 SASI_Rn01_00096687 predicted 1019
7 SASI_Rn01_00096688 predicted 289
8 SASI_Rn02_00259717 predicted 829
9 SASI_Rn01_00096692 predicted 1190
10 SASI_Rn01_00096689 predicted 1044
11 SASI_Rn01_00096684 predicted 1010
12 SASI_Rn01_00096690 predicted 1004
13 SASI_Rn01_00096691 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198358 predicted 992
2 SASI_Mm01_00198359 predicted 464
3 SASI_Mm02_00318625 predicted 705
4 SASI_Mm01_00198360 predicted 1337
5 SASI_Mm01_00198361 predicted 1225
6 SASI_Mm01_00198362 predicted 1049
7 SASI_Mm01_00198364 predicted 319
8 SASI_Mm01_00198365 predicted 609
9 SASI_Mm01_00198366 predicted 1081
10 SASI_Mm02_00318626 predicted 861
11 SASI_Mm01_00198363 predicted 1435
12 SASI_Mm01_00198367 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006735
HOXA2 MISSION shRNA Bacterial Glycerol Stock
homeobox A2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000015059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-1100s1c1
Sequence:CCGGGCCTTTAACCAGCAATGAGAACTCGAGTTCTCATTGCTGGTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006735.3-1561s1c1
Sequence:CCGGCCCAGTTTCAAACAGAGCCATCTCGAGATGGCTCTGTTTGAAACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-398s1c1
Sequence:CCGGGCTTTCACACTCGACACTGATCTCGAGATCAGTGTCGAGTGTGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-1285s1c1
Sequence:CCGGCAGATGCAGTTTCACCCAGTTCTCGAGAACTGGGTGAAACTGCATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006735
HOXA2 MISSION shRNA shRNA Plasmid DNA
homeobox A2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000015059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-1100s1c1
Sequence:CCGGGCCTTTAACCAGCAATGAGAACTCGAGTTCTCATTGCTGGTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006735.3-1561s1c1
Sequence:CCGGCCCAGTTTCAAACAGAGCCATCTCGAGATGGCTCTGTTTGAAACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-398s1c1
Sequence:CCGGGCTTTCACACTCGACACTGATCTCGAGATCAGTGTCGAGTGTGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-1285s1c1
Sequence:CCGGCAGATGCAGTTTCACCCAGTTCTCGAGAACTGGGTGAAACTGCATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006735
HOXA2 MISSION shRNA Lentiviral Transduction Particles
homeobox A2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000015059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-1100s1c1
Sequence:CCGGGCCTTTAACCAGCAATGAGAACTCGAGTTCTCATTGCTGGTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006735.3-1561s1c1
Sequence:CCGGCCCAGTTTCAAACAGAGCCATCTCGAGATGGCTCTGTTTGAAACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-398s1c1
Sequence:CCGGGCTTTCACACTCGACACTGATCTCGAGATCAGTGTCGAGTGTGAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006735.3-1285s1c1
Sequence:CCGGCAGATGCAGTTTCACCCAGTTCTCGAGAACTGGGTGAAACTGCATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010451
HOXA2 MISSION shRNA Bacterial Glycerol Stock
homeobox A2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-1066s1c1
Sequence:CCGGCTTGTCAACAATGGGCCAGAACTCGAGTTCTGGCCCATTGTTGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-854s1c1
Sequence:CCGGGAGGAAGAGAAGTCACTCTTTCTCGAGAAAGAGTGACTTCTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-1285s1c1
Sequence:CCGGCCTACAGCATCTGAATTACTACTCGAGTAGTAATTCAGATGCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-621s1c1
Sequence:CCGGCGTACACCAACACTCAGCTTTCTCGAGAAAGCTGAGTGTTGGTGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-266s1c1
Sequence:CCGGCCTGTCGCTGATACATTTCAACTCGAGTTGAAATGTATCAGCGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010451.1-987s21c1
Sequence:CCGGCTTTCCCAGTTTCGCCTTTAACTCGAGTTAAAGGCGAAACTGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010451.1-753s21c1
Sequence:CCGGACCGGAGAATGAAGCATAAGACTCGAGTCTTATGCTTCATTCTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010451.1-1476s21c1
Sequence:CCGGAGCCATCTCTTGCAAATTATGCTCGAGCATAATTTGCAAGAGATGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010451.1-1522s21c1
Sequence:CCGGAGAACCCAACAAGCTTCTATGCTCGAGCATAGAAGCTTGTTGGGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010451
HOXA2 MISSION shRNA shRNA Plasmid DNA
homeobox A2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-1066s1c1
Sequence:CCGGCTTGTCAACAATGGGCCAGAACTCGAGTTCTGGCCCATTGTTGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-854s1c1
Sequence:CCGGGAGGAAGAGAAGTCACTCTTTCTCGAGAAAGAGTGACTTCTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-1285s1c1
Sequence:CCGGCCTACAGCATCTGAATTACTACTCGAGTAGTAATTCAGATGCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-621s1c1
Sequence:CCGGCGTACACCAACACTCAGCTTTCTCGAGAAAGCTGAGTGTTGGTGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-266s1c1
Sequence:CCGGCCTGTCGCTGATACATTTCAACTCGAGTTGAAATGTATCAGCGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010451.1-987s21c1
Sequence:CCGGCTTTCCCAGTTTCGCCTTTAACTCGAGTTAAAGGCGAAACTGGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010451.1-753s21c1
Sequence:CCGGACCGGAGAATGAAGCATAAGACTCGAGTCTTATGCTTCATTCTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010451.1-1476s21c1
Sequence:CCGGAGCCATCTCTTGCAAATTATGCTCGAGCATAATTTGCAAGAGATGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010451.1-1522s21c1
Sequence:CCGGAGAACCCAACAAGCTTCTATGCTCGAGCATAGAAGCTTGTTGGGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010451
HOXA2 MISSION shRNA Lentiviral Transduction Particles
homeobox A2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-1066s1c1
Sequence:CCGGCTTGTCAACAATGGGCCAGAACTCGAGTTCTGGCCCATTGTTGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-854s1c1
Sequence:CCGGGAGGAAGAGAAGTCACTCTTTCTCGAGAAAGAGTGACTTCTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-1285s1c1
Sequence:CCGGCCTACAGCATCTGAATTACTACTCGAGTAGTAATTCAGATGCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-621s1c1
Sequence:CCGGCGTACACCAACACTCAGCTTTCTCGAGAAAGCTGAGTGTTGGTGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010451.1-266s1c1
Sequence:CCGGCCTGTCGCTGATACATTTCAACTCGAGTTGAAATGTATCAGCGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010451.1-987s21c1
Sequence:CCGGCTTTCCCAGTTTCGCCTTTAACTCGAGTTAAAGGCGAAACTGGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010451.1-753s21c1
Sequence:CCGGACCGGAGAATGAAGCATAAGACTCGAGTCTTATGCTTCATTCTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010451.1-1476s21c1
Sequence:CCGGAGCCATCTCTTGCAAATTATGCTCGAGCATAATTTGCAAGAGATGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010451.1-1522s21c1
Sequence:CCGGAGAACCCAACAAGCTTCTATGCTCGAGCATAGAAGCTTGTTGGGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)