EMAIL THIS PAGE TO A FRIEND

HOXA3

homeobox A3

164 Gene Product Result for
Synonyms: HOX1 HOX1E
UniProtKB ID: O43365, A4D181
Gene ID:
Human(3200) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15400) homeobox A3
Rat(500125) homeobox A3
chicken(395231) homeobox A3
cow(509991) homeobox A3
dog(482368) homeobox A3
sheep(101115026) homeobox A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36056 Anti-HOXA3 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, bovine, horse, rabbit, zebrafish, rabbit, human, canine, rat
western blot pricing
AV37882 Anti-HOXA3 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat
western blot pricing
SAB2101065 Anti-HOXA3 antibody produced in rabbit affinity isolated antibody canine, rabbit, rabbit, guinea pig, rat, horse, bovine, human, mouse
western blot pricing
HPA029157 Anti-HOXA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
H3791 Anti-HOXA3 antibody produced in rabbit ~1.0 mL/mL, affinity isolated antibody mouse, human
immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030661 Rosetta Predictions human pricing
NM_153631 Rosetta Predictions human pricing
NM_153632 Rosetta Predictions human pricing
XM_001058923 Rosetta Predictions rat pricing
XM_575477 Rosetta Predictions rat pricing
NM_010452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028447 predicted 1341
2 SASI_Hs01_00028449 predicted 1029
3 SASI_Hs01_00028450 predicted 1743
4 SASI_Hs01_00028451 predicted 1860
5 SASI_Hs02_00358244 predicted 1738
6 SASI_Hs01_00028452 predicted 1702
7 SASI_Hs02_00358245 predicted 1817
8 SASI_Hs01_00028453 predicted 260
9 SASI_Hs01_00028454 predicted 273
10 SASI_Hs01_00028456 predicted 1517
11 SASI_Hs01_00028448 predicted 886
12 SASI_Hs01_00028455 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212601 predicted 1479
2 SASI_Hs01_00212603 predicted 1165
3 SASI_Hs01_00212604 predicted 1880
4 SASI_Hs01_00212605 predicted 2003
5 SASI_Hs02_00367370 predicted 1879
6 SASI_Hs01_00212606 predicted 1844
7 SASI_Hs02_00367371 predicted 1965
8 SASI_Hs01_00212607 predicted 402
9 SASI_Hs01_00212608 predicted 405
10 SASI_Hs01_00212610 predicted 1657
11 SASI_Hs01_00212602 predicted 1030
12 SASI_Hs01_00212609 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146336 predicted 852
2 SASI_Hs01_00146338 predicted 546
3 SASI_Hs02_00367372 predicted 1263
4 SASI_Hs01_00146339 predicted 1252
5 SASI_Hs01_00146340 predicted 1373
6 SASI_Hs01_00146341 predicted 1253
7 SASI_Hs01_00146342 predicted 1216
8 SASI_Hs01_00146343 predicted 1341
9 SASI_Hs01_00146344 predicted 1033
10 SASI_Hs01_00146345 predicted 1517
11 SASI_Hs01_00146337 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291273 predicted 1481
2 SASI_Rn02_00291274 predicted 1776
3 SASI_Rn02_00291275 predicted 1616
4 SASI_Rn02_00291276 predicted 1618
5 SASI_Rn02_00291277 predicted 1605
6 SASI_Rn02_00291278 predicted 1692
7 SASI_Rn02_00291279 predicted 1153
8 SASI_Rn02_00291280 predicted 1707
9 SASI_Rn02_00291281 predicted 1154
10 SASI_Rn02_00291282 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172077 predicted 264
2 SASI_Rn01_00172078 predicted 265
3 SASI_Rn01_00172079 predicted 264
4 SASI_Rn01_00172080 predicted 1028
5 SASI_Rn01_00172081 predicted 933
6 SASI_Rn01_00172082 predicted 1025
7 SASI_Rn01_00172083 predicted 1054
8 SASI_Rn01_00172084 predicted 959
9 SASI_Rn01_00172085 predicted 959
10 SASI_Rn01_00172086 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057894 predicted 365
2 SASI_Mm01_00057895 predicted 1448
3 SASI_Mm01_00057896 predicted 319
4 SASI_Mm01_00057897 predicted 368
5 SASI_Mm01_00057898 predicted 380
6 SASI_Mm01_00057899 predicted 1159
7 SASI_Mm01_00057901 predicted 1130
8 SASI_Mm01_00057902 predicted 367
9 SASI_Mm02_00318627 predicted 790
10 SASI_Mm02_00318628 predicted 2133
11 SASI_Mm01_00057900 predicted 1158
12 SASI_Mm01_00057903 predicted 1951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010452
HOXA3 MISSION shRNA Bacterial Glycerol Stock
homeobox A3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1011s21c1
Sequence:CCGGCAACCTGCTGAACCTCACCGACTCGAGTCGGTGAGGTTCAGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1038s21c1
Sequence:CCGGGATCAAGATCTGGTTCCAGAACTCGAGTTCTGGAACCAGATCTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1025s21c1
Sequence:CCGGTCACCGAGCGCCAGATCAAGACTCGAGTCTTGATCTGGCGCTCGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1614s21c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010452.2-1680s1c1
Sequence:CCGGCCGACCTTCTTTGGTTACTTTCTCGAGAAAGTAACCAAAGAAGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-760s1c1
Sequence:CCGGACCGTGGGCAAACAAATCTTTCTCGAGAAAGATTTGTTTGCCCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-370s1c1
Sequence:CCGGGCCAATGGGTTCGCTTACAATCTCGAGATTGTAAGCGAACCCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-1158s1c1
Sequence:CCGGGCTGGTCAACAGTGTCCCATACTCGAGTATGGGACACTGTTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-1036s1c1
Sequence:CCGGCGCCGCATGAAGTACAAGAAACTCGAGTTTCTTGTACTTCATGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010452
HOXA3 MISSION shRNA shRNA Plasmid DNA
homeobox A3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1011s21c1
Sequence:CCGGCAACCTGCTGAACCTCACCGACTCGAGTCGGTGAGGTTCAGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1038s21c1
Sequence:CCGGGATCAAGATCTGGTTCCAGAACTCGAGTTCTGGAACCAGATCTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1025s21c1
Sequence:CCGGTCACCGAGCGCCAGATCAAGACTCGAGTCTTGATCTGGCGCTCGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1614s21c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010452.2-1680s1c1
Sequence:CCGGCCGACCTTCTTTGGTTACTTTCTCGAGAAAGTAACCAAAGAAGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-760s1c1
Sequence:CCGGACCGTGGGCAAACAAATCTTTCTCGAGAAAGATTTGTTTGCCCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-370s1c1
Sequence:CCGGGCCAATGGGTTCGCTTACAATCTCGAGATTGTAAGCGAACCCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-1158s1c1
Sequence:CCGGGCTGGTCAACAGTGTCCCATACTCGAGTATGGGACACTGTTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-1036s1c1
Sequence:CCGGCGCCGCATGAAGTACAAGAAACTCGAGTTTCTTGTACTTCATGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010452
HOXA3 MISSION shRNA Lentiviral Transduction Particles
homeobox A3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1011s21c1
Sequence:CCGGCAACCTGCTGAACCTCACCGACTCGAGTCGGTGAGGTTCAGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1038s21c1
Sequence:CCGGGATCAAGATCTGGTTCCAGAACTCGAGTTCTGGAACCAGATCTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1025s21c1
Sequence:CCGGTCACCGAGCGCCAGATCAAGACTCGAGTCTTGATCTGGCGCTCGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010452.3-1614s21c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010452.2-1680s1c1
Sequence:CCGGCCGACCTTCTTTGGTTACTTTCTCGAGAAAGTAACCAAAGAAGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-760s1c1
Sequence:CCGGACCGTGGGCAAACAAATCTTTCTCGAGAAAGATTTGTTTGCCCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-370s1c1
Sequence:CCGGGCCAATGGGTTCGCTTACAATCTCGAGATTGTAAGCGAACCCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-1158s1c1
Sequence:CCGGGCTGGTCAACAGTGTCCCATACTCGAGTATGGGACACTGTTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010452.2-1036s1c1
Sequence:CCGGCGCCGCATGAAGTACAAGAAACTCGAGTTTCTTGTACTTCATGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030661
VALIDATED
HOXA3 MISSION shRNA Bacterial Glycerol Stock
homeobox A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1019s21c1
Sequence:CCGGCGGTGGCTATCTGAACTCTATCTCGAGATAGAGTTCAGATAGCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030661.4-2011s21c1
Sequence:CCGGATGACTAAGTGTACGTCTTTCCTCGAGGAAAGACGTACACTTAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1481s21c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030661.4-955s21c1
Sequence:CCGGGCAAGGGCATGCTAACGTCATCTCGAGATGACGTTAGCATGCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1338s21c1
Sequence:CCGGCCAGCCCTCTTTGGTCTAACTCTCGAGAGTTAGACCAAAGAGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030661.3-1745s1c1
Sequence:CCGGGCTGTATCATAGCGATATTTACTCGAGTAAATATCGCTATGATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_030661.3-1019s1c1
Sequence:CCGGCGGTGGCTATCTGAACTCTATCTCGAGATAGAGTTCAGATAGCCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030661.3-261s1c1
Sequence:CCGGGCCAACGGGTTCGCTTATAATCTCGAGATTATAAGCGAACCCGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030661.3-581s1c1
Sequence:CCGGTCCTCAGAATGCCAGCAACAACTCGAGTTGTTGCTGGCATTCTGAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_030661.3-1481s1c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030661
VALIDATED
HOXA3 MISSION shRNA shRNA Plasmid DNA
homeobox A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1019s21c1
Sequence:CCGGCGGTGGCTATCTGAACTCTATCTCGAGATAGAGTTCAGATAGCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030661.4-2011s21c1
Sequence:CCGGATGACTAAGTGTACGTCTTTCCTCGAGGAAAGACGTACACTTAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1481s21c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030661.4-955s21c1
Sequence:CCGGGCAAGGGCATGCTAACGTCATCTCGAGATGACGTTAGCATGCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1338s21c1
Sequence:CCGGCCAGCCCTCTTTGGTCTAACTCTCGAGAGTTAGACCAAAGAGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030661.3-1745s1c1
Sequence:CCGGGCTGTATCATAGCGATATTTACTCGAGTAAATATCGCTATGATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_030661.3-1019s1c1
Sequence:CCGGCGGTGGCTATCTGAACTCTATCTCGAGATAGAGTTCAGATAGCCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030661.3-261s1c1
Sequence:CCGGGCCAACGGGTTCGCTTATAATCTCGAGATTATAAGCGAACCCGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030661.3-581s1c1
Sequence:CCGGTCCTCAGAATGCCAGCAACAACTCGAGTTGTTGCTGGCATTCTGAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_030661.3-1481s1c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030661
VALIDATED
HOXA3 MISSION shRNA Lentiviral Transduction Particles
homeobox A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1019s21c1
Sequence:CCGGCGGTGGCTATCTGAACTCTATCTCGAGATAGAGTTCAGATAGCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030661.4-2011s21c1
Sequence:CCGGATGACTAAGTGTACGTCTTTCCTCGAGGAAAGACGTACACTTAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1481s21c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030661.4-955s21c1
Sequence:CCGGGCAAGGGCATGCTAACGTCATCTCGAGATGACGTTAGCATGCCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_030661.4-1338s21c1
Sequence:CCGGCCAGCCCTCTTTGGTCTAACTCTCGAGAGTTAGACCAAAGAGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030661.3-1745s1c1
Sequence:CCGGGCTGTATCATAGCGATATTTACTCGAGTAAATATCGCTATGATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_030661.3-1019s1c1
Sequence:CCGGCGGTGGCTATCTGAACTCTATCTCGAGATAGAGTTCAGATAGCCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030661.3-261s1c1
Sequence:CCGGGCCAACGGGTTCGCTTATAATCTCGAGATTATAAGCGAACCCGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030661.3-581s1c1
Sequence:CCGGTCCTCAGAATGCCAGCAACAACTCGAGTTGTTGCTGGCATTCTGAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_030661.3-1481s1c1
Sequence:CCGGCCATCCTTCTCAGGGAAGAATCTCGAGATTCTTCCCTGAGAAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)