EMAIL THIS PAGE TO A FRIEND

HOXA4

homeobox A4

94 Gene Product Result for
Synonyms: HOX1 HOX1D
UniProtKB ID: Q00056, A4D180, O43366
Gene ID:
Human(3201) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. [provided by RefSeq, Jul 2008]
Mouse(15401) homeobox A4
Rat(24453) homeo box A4
chicken(395307) homeobox A4
dog(482369) homeobox A4
cow(538865) homeobox A4
sheep(101114773) homeobox A4
sheep(443357) homeobox A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016441 MISSION® esiRNA esiRNA targeting human HOXA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002141 Rosetta Predictions human pricing
NM_008265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010831 predicted 1492
2 SASI_Hs01_00010832 predicted 1467
3 SASI_Hs01_00010833 predicted 1425
4 SASI_Hs01_00010834 predicted 1437
5 SASI_Hs01_00010835 predicted 1273
6 SASI_Hs01_00010836 predicted 1341
7 SASI_Hs02_00333320 predicted 1341
8 SASI_Hs02_00333321 predicted 1429
9 SASI_Hs02_00333322 predicted 1435
10 SASI_Hs01_00010837 predicted 1428
11 SASI_Hs01_00010838 predicted 1457
12 SASI_Hs01_00010839 predicted 686
13 SASI_Hs01_00010840 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096936 predicted 1230
2 SASI_Mm01_00096937 predicted 977
3 SASI_Mm01_00096938 predicted 1258
4 SASI_Mm01_00096939 predicted 1058
5 SASI_Mm01_00096940 predicted 1100
6 SASI_Mm02_00313492 predicted 1176
7 SASI_Mm01_00096941 predicted 1004
8 SASI_Mm01_00096942 predicted 929
9 SASI_Mm01_00096943 predicted 1265
10 SASI_Mm02_00313493 predicted 1251
11 SASI_Mm01_00096935 predicted 909
12 SASI_Mm01_00096944 predicted 1185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002141
VALIDATED
HOXA4 MISSION shRNA Bacterial Glycerol Stock
homeobox A4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-788s1c1
Sequence:CCGGGATCGCCCACACGCTCTGTTTCTCGAGAAACAGAGCGTGTGGGCGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-1313s1c1
Sequence:CCGGGCAGAAGAAGACAGACCCTTTCTCGAGAAAGGGTCTGTCTTCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-647s1c1
Sequence:CCGGGATCCATGTCAGCGCCGTTAACTCGAGTTAACGGCGCTGACATGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002141.2-77s1c1
Sequence:CCGGCAACTACATCGAGCCCAAGTTCTCGAGAACTTGGGCTCGATGTAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-860s1c1
Sequence:CCGGGAAAGACCACAAACTGCCCAACTCGAGTTGGGCAGTTTGTGGTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002141.4-744s21c1
Sequence:CCGGGAGTTCCACTTCAATCGATACCTCGAGGTATCGATTGAAGTGGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002141.4-1277s21c1
Sequence:CCGGAGGACTACTTGGTATCAAATACTCGAGTATTTGATACCAAGTAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002141
VALIDATED
HOXA4 MISSION shRNA shRNA Plasmid DNA
homeobox A4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-788s1c1
Sequence:CCGGGATCGCCCACACGCTCTGTTTCTCGAGAAACAGAGCGTGTGGGCGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-1313s1c1
Sequence:CCGGGCAGAAGAAGACAGACCCTTTCTCGAGAAAGGGTCTGTCTTCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-647s1c1
Sequence:CCGGGATCCATGTCAGCGCCGTTAACTCGAGTTAACGGCGCTGACATGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002141.2-77s1c1
Sequence:CCGGCAACTACATCGAGCCCAAGTTCTCGAGAACTTGGGCTCGATGTAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-860s1c1
Sequence:CCGGGAAAGACCACAAACTGCCCAACTCGAGTTGGGCAGTTTGTGGTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002141.4-744s21c1
Sequence:CCGGGAGTTCCACTTCAATCGATACCTCGAGGTATCGATTGAAGTGGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002141.4-1277s21c1
Sequence:CCGGAGGACTACTTGGTATCAAATACTCGAGTATTTGATACCAAGTAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002141
VALIDATED
HOXA4 MISSION shRNA Lentiviral Transduction Particles
homeobox A4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-788s1c1
Sequence:CCGGGATCGCCCACACGCTCTGTTTCTCGAGAAACAGAGCGTGTGGGCGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-1313s1c1
Sequence:CCGGGCAGAAGAAGACAGACCCTTTCTCGAGAAAGGGTCTGTCTTCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-647s1c1
Sequence:CCGGGATCCATGTCAGCGCCGTTAACTCGAGTTAACGGCGCTGACATGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002141.2-77s1c1
Sequence:CCGGCAACTACATCGAGCCCAAGTTCTCGAGAACTTGGGCTCGATGTAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002141.2-860s1c1
Sequence:CCGGGAAAGACCACAAACTGCCCAACTCGAGTTGGGCAGTTTGTGGTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002141.4-744s21c1
Sequence:CCGGGAGTTCCACTTCAATCGATACCTCGAGGTATCGATTGAAGTGGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002141.4-1277s21c1
Sequence:CCGGAGGACTACTTGGTATCAAATACTCGAGTATTTGATACCAAGTAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008265
HOXA4 MISSION shRNA Bacterial Glycerol Stock
homeobox A4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-741s1c1
Sequence:CCGGCCAACACCAAGATGCGATCTTCTCGAGAAGATCGCATCTTGGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-730s1c1
Sequence:CCGGCCACAAACTTCCCAACACCAACTCGAGTTGGTGTTGGGAAGTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-523s1c1
Sequence:CCGGCGCCGTCAACTCCAGTTATAACTCGAGTTATAACTGGAGTTGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-55s1c1
Sequence:CCGGCGAGCCCAAGTTCCCTCCTTTCTCGAGAAAGGAGGGAACTTGGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-707s1c1
Sequence:CCGGCGGAGAATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008265
HOXA4 MISSION shRNA shRNA Plasmid DNA
homeobox A4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-741s1c1
Sequence:CCGGCCAACACCAAGATGCGATCTTCTCGAGAAGATCGCATCTTGGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-730s1c1
Sequence:CCGGCCACAAACTTCCCAACACCAACTCGAGTTGGTGTTGGGAAGTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-523s1c1
Sequence:CCGGCGCCGTCAACTCCAGTTATAACTCGAGTTATAACTGGAGTTGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-55s1c1
Sequence:CCGGCGAGCCCAAGTTCCCTCCTTTCTCGAGAAAGGAGGGAACTTGGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-707s1c1
Sequence:CCGGCGGAGAATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008265
HOXA4 MISSION shRNA Lentiviral Transduction Particles
homeobox A4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-741s1c1
Sequence:CCGGCCAACACCAAGATGCGATCTTCTCGAGAAGATCGCATCTTGGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-730s1c1
Sequence:CCGGCCACAAACTTCCCAACACCAACTCGAGTTGGTGTTGGGAAGTTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-523s1c1
Sequence:CCGGCGCCGTCAACTCCAGTTATAACTCGAGTTATAACTGGAGTTGACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-55s1c1
Sequence:CCGGCGAGCCCAAGTTCCCTCCTTTCTCGAGAAAGGAGGGAACTTGGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008265.1-707s1c1
Sequence:CCGGCGGAGAATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)