EMAIL THIS PAGE TO A FRIEND

HOXA5

homeobox A5

117 Gene Product Result for
Synonyms: HOX1 HOX1.3 HOX1C
UniProtKB ID: P20719, A4D179, O43367, Q96CY6
Gene ID:
Human(3202) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(15402) homeobox A5
Rat(79241) homeo box A5
chicken(100858404) homeobox A5
dog(482370) homeobox A5
cow(768039) homeobox A5
sheep(101114518) homeobox A5
sheep(443358) homeobox A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405956 Anti-HOXA5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411958 ANTI-HOXA5 antibody produced in mouse clone 1C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412462 ANTI-HOXA5 antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412463 ANTI-HOXA5 antibody produced in mouse clone 4A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412464 ANTI-HOXA5 antibody produced in mouse clone 4E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412465 ANTI-HOXA5 antibody produced in mouse clone 3F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412466 ANTI-HOXA5 antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412467 ANTI-HOXA5 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412483 ANTI-HOXA5 antibody produced in mouse clone 3E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412484 ANTI-HOXA5 antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412568 ANTI-HOXA5 antibody produced in mouse clone 4F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412569 ANTI-HOXA5 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412570 ANTI-HOXA5 antibody produced in mouse clone 4E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412571 ANTI-HOXA5 antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412572 ANTI-HOXA5 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
H9790 Anti-HOXA5 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2101066 Anti-HOXA5 antibody produced in rabbit affinity isolated antibody rat, horse, mouse, guinea pig, rabbit, human
immunohistochemistry, western blot pricing
HPA029319 Anti-HOXA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103145 Anti-HOXA5 antibody produced in rabbit affinity isolated antibody mouse, canine, human, pig, rabbit, horse, rat, bovine
immunohistochemistry, western blot pricing
SAB1304726 ANTI-MOUSE HOXA5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
WH0003202M1 Monoclonal Anti-HOXA5 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403932 Monoclonal Anti-HOXA5, (C-terminal) antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019102 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060131 MISSION® esiRNA esiRNA targeting mouse Hoxa5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019102 Rosetta Predictions human pricing
XM_001059031 Rosetta Predictions rat pricing
XM_001064984 Rosetta Predictions rat pricing
NM_010453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089930 predicted 604
2 SASI_Hs01_00089932 predicted 752
3 SASI_Hs01_00089933 predicted 871
4 SASI_Hs01_00089935 predicted 608
5 SASI_Hs01_00089936 predicted 866
6 SASI_Hs01_00089937 predicted 201
7 SASI_Hs01_00089938 predicted 728
8 SASI_Hs01_00089939 predicted 330
9 SASI_Hs02_00352724 predicted 237
10 SASI_Hs02_00352725 predicted 605
11 SASI_Hs01_00089931 predicted 657
12 SASI_Hs01_00089934 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291671 predicted 380
2 SASI_Rn02_00291672 predicted 394
3 SASI_Rn02_00291673 predicted 200
4 SASI_Rn02_00291674 predicted 991
5 SASI_Rn02_00291675 predicted 1141
6 SASI_Rn02_00291676 predicted 382
7 SASI_Rn02_00291677 predicted 380
8 SASI_Rn02_00291678 predicted 224
9 SASI_Rn02_00291679 predicted 301
10 SASI_Rn02_00291680 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312480 predicted 376
2 SASI_Rn02_00312481 predicted 387
3 SASI_Rn02_00312482 predicted 204
4 SASI_Rn02_00312483 predicted 992
5 SASI_Rn02_00312484 predicted 1145
6 SASI_Rn02_00312485 predicted 384
7 SASI_Rn02_00312486 predicted 386
8 SASI_Rn02_00312487 predicted 224
9 SASI_Rn02_00312488 predicted 300
10 SASI_Rn02_00312489 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118532 predicted 782
2 SASI_Mm01_00118533 predicted 777
3 SASI_Mm01_00118534 predicted 284
4 SASI_Mm01_00118536 predicted 278
5 SASI_Mm01_00118537 predicted 376
6 SASI_Mm01_00118538 predicted 289
7 SASI_Mm02_00318629 predicted 780
8 SASI_Mm01_00118540 predicted 375
9 SASI_Mm01_00118541 predicted 359
10 SASI_Mm02_00318630 predicted 920
11 SASI_Mm01_00118535 predicted 367
12 SASI_Mm01_00118539 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010453
VALIDATED
HOXA5 MISSION shRNA Bacterial Glycerol Stock
homeobox A5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-783s21c1
Sequence:CCGGGCTGCACATTAGTCACGACAACTCGAGTTGTCGTGACTAATGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-286s21c1
Sequence:CCGGCCGGACTACCAGTTGCATAATCTCGAGATTATGCAACTGGTAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-901s21c1
Sequence:CCGGCGCCGAAGAAGGATCGAAATACTCGAGTATTTCGATCCTTCTTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010453.5-1160s21c1
Sequence:CCGGCTGTTCTCGTTGCCCTAATTCCTCGAGGAATTAGGGCAACGAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-936s21c1
Sequence:CCGGCCTCTCCGAGAGACAAATTAACTCGAGTTAATTTGTCTCTCGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010453.2-936s1c1
Sequence:CCGGCCTCTCCGAGAGACAAATTAACTCGAGTTAATTTGTCTCTCGGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010453.2-286s1c1
Sequence:CCGGCCGGACTACCAGTTGCATAATCTCGAGATTATGCAACTGGTAGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010453.2-901s1c1
Sequence:CCGGCGCCGAAGAAGGATCGAAATACTCGAGTATTTCGATCCTTCTTCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010453.2-783s1c1
Sequence:CCGGGCTGCACATTAGTCACGACAACTCGAGTTGTCGTGACTAATGTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010453.2-1684s1c1
Sequence:CCGGCGCAGTTCAGTGATGTATGTTCTCGAGAACATACATCACTGAACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010453
VALIDATED
HOXA5 MISSION shRNA shRNA Plasmid DNA
homeobox A5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-783s21c1
Sequence:CCGGGCTGCACATTAGTCACGACAACTCGAGTTGTCGTGACTAATGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-286s21c1
Sequence:CCGGCCGGACTACCAGTTGCATAATCTCGAGATTATGCAACTGGTAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-901s21c1
Sequence:CCGGCGCCGAAGAAGGATCGAAATACTCGAGTATTTCGATCCTTCTTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010453.5-1160s21c1
Sequence:CCGGCTGTTCTCGTTGCCCTAATTCCTCGAGGAATTAGGGCAACGAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-936s21c1
Sequence:CCGGCCTCTCCGAGAGACAAATTAACTCGAGTTAATTTGTCTCTCGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010453.2-936s1c1
Sequence:CCGGCCTCTCCGAGAGACAAATTAACTCGAGTTAATTTGTCTCTCGGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010453.2-286s1c1
Sequence:CCGGCCGGACTACCAGTTGCATAATCTCGAGATTATGCAACTGGTAGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010453.2-901s1c1
Sequence:CCGGCGCCGAAGAAGGATCGAAATACTCGAGTATTTCGATCCTTCTTCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010453.2-783s1c1
Sequence:CCGGGCTGCACATTAGTCACGACAACTCGAGTTGTCGTGACTAATGTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010453.2-1684s1c1
Sequence:CCGGCGCAGTTCAGTGATGTATGTTCTCGAGAACATACATCACTGAACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010453
VALIDATED
HOXA5 MISSION shRNA Lentiviral Transduction Particles
homeobox A5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-783s21c1
Sequence:CCGGGCTGCACATTAGTCACGACAACTCGAGTTGTCGTGACTAATGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-286s21c1
Sequence:CCGGCCGGACTACCAGTTGCATAATCTCGAGATTATGCAACTGGTAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-901s21c1
Sequence:CCGGCGCCGAAGAAGGATCGAAATACTCGAGTATTTCGATCCTTCTTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010453.5-1160s21c1
Sequence:CCGGCTGTTCTCGTTGCCCTAATTCCTCGAGGAATTAGGGCAACGAGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010453.5-936s21c1
Sequence:CCGGCCTCTCCGAGAGACAAATTAACTCGAGTTAATTTGTCTCTCGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010453.2-936s1c1
Sequence:CCGGCCTCTCCGAGAGACAAATTAACTCGAGTTAATTTGTCTCTCGGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010453.2-286s1c1
Sequence:CCGGCCGGACTACCAGTTGCATAATCTCGAGATTATGCAACTGGTAGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010453.2-901s1c1
Sequence:CCGGCGCCGAAGAAGGATCGAAATACTCGAGTATTTCGATCCTTCTTCGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010453.2-783s1c1
Sequence:CCGGGCTGCACATTAGTCACGACAACTCGAGTTGTCGTGACTAATGTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010453.2-1684s1c1
Sequence:CCGGCGCAGTTCAGTGATGTATGTTCTCGAGAACATACATCACTGAACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019102
VALIDATED
HOXA5 MISSION shRNA Bacterial Glycerol Stock
homeobox A5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-111s21c1
Sequence:CCGGCGGACTACCAGTTGCATAATTCTCGAGAATTATGCAACTGGTAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-724s21c1
Sequence:CCGGCCGCAGAAGGAGGATTGAAATCTCGAGATTTCAATCCTCCTTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019102.2-915s21c1
Sequence:CCGGCCGCGTAGTGTCAGTACTAAGCTCGAGCTTAGTACTGACACTACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-871s21c1
Sequence:CCGGCTGAGTATCTGAGCGTTTAAACTCGAGTTTAAACGCTCAGATACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-142s21c1
Sequence:CCGGTAGTTCCGTGAGCGAGCAATTCTCGAGAATTGCTCGCTCACGGAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019102.2-1026s1c1
Sequence:CCGGGCCATTATAGCGCCTGTATAACTCGAGTTATACAGGCGCTATAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-607s1c1
Sequence:CCGGGCTGCACATAAGTCATGACAACTCGAGTTGTCATGACTTATGTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-200s1c1
Sequence:CCGGTACGGCTACAATGGCATGGATCTCGAGATCCATGCCATTGTAGCCGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-119s1c1
Sequence:CCGGCAGTTGCATAATTATGGAGATCTCGAGATCTCCATAATTATGCAACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019102.2-724s1c1
Sequence:CCGGCCGCAGAAGGAGGATTGAAATCTCGAGATTTCAATCCTCCTTCTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019102
VALIDATED
HOXA5 MISSION shRNA shRNA Plasmid DNA
homeobox A5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-111s21c1
Sequence:CCGGCGGACTACCAGTTGCATAATTCTCGAGAATTATGCAACTGGTAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-724s21c1
Sequence:CCGGCCGCAGAAGGAGGATTGAAATCTCGAGATTTCAATCCTCCTTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019102.2-915s21c1
Sequence:CCGGCCGCGTAGTGTCAGTACTAAGCTCGAGCTTAGTACTGACACTACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-871s21c1
Sequence:CCGGCTGAGTATCTGAGCGTTTAAACTCGAGTTTAAACGCTCAGATACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-142s21c1
Sequence:CCGGTAGTTCCGTGAGCGAGCAATTCTCGAGAATTGCTCGCTCACGGAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019102.2-1026s1c1
Sequence:CCGGGCCATTATAGCGCCTGTATAACTCGAGTTATACAGGCGCTATAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-607s1c1
Sequence:CCGGGCTGCACATAAGTCATGACAACTCGAGTTGTCATGACTTATGTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-200s1c1
Sequence:CCGGTACGGCTACAATGGCATGGATCTCGAGATCCATGCCATTGTAGCCGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-119s1c1
Sequence:CCGGCAGTTGCATAATTATGGAGATCTCGAGATCTCCATAATTATGCAACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019102.2-724s1c1
Sequence:CCGGCCGCAGAAGGAGGATTGAAATCTCGAGATTTCAATCCTCCTTCTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019102
VALIDATED
HOXA5 MISSION shRNA Lentiviral Transduction Particles
homeobox A5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-111s21c1
Sequence:CCGGCGGACTACCAGTTGCATAATTCTCGAGAATTATGCAACTGGTAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-724s21c1
Sequence:CCGGCCGCAGAAGGAGGATTGAAATCTCGAGATTTCAATCCTCCTTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019102.2-915s21c1
Sequence:CCGGCCGCGTAGTGTCAGTACTAAGCTCGAGCTTAGTACTGACACTACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-871s21c1
Sequence:CCGGCTGAGTATCTGAGCGTTTAAACTCGAGTTTAAACGCTCAGATACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019102.2-142s21c1
Sequence:CCGGTAGTTCCGTGAGCGAGCAATTCTCGAGAATTGCTCGCTCACGGAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019102.2-1026s1c1
Sequence:CCGGGCCATTATAGCGCCTGTATAACTCGAGTTATACAGGCGCTATAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-607s1c1
Sequence:CCGGGCTGCACATAAGTCATGACAACTCGAGTTGTCATGACTTATGTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-200s1c1
Sequence:CCGGTACGGCTACAATGGCATGGATCTCGAGATCCATGCCATTGTAGCCGTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019102.2-119s1c1
Sequence:CCGGCAGTTGCATAATTATGGAGATCTCGAGATCTCCATAATTATGCAACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019102.2-724s1c1
Sequence:CCGGCCGCAGAAGGAGGATTGAAATCTCGAGATTTCAATCCTCCTTCTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)