EMAIL THIS PAGE TO A FRIEND

HOXA6

homeobox A6

48 Gene Product Result for
Synonyms: HOX1 HOX1.2 HOX1B
UniProtKB ID: P31267, A4D192, Q2M3G3, Q9UPM0
Gene ID:
Human(3203) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. [provided by RefSeq, Jul 2008]
Mouse(15403) homeobox A6
Rat(685732) homeobox A6
chicken(420630) homeobox A6
cow(100848736) homeobox A6
Horse(100054438) homeobox A6
dog(611383) homeobox A6
sheep(101105905) homeobox A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU158631 MISSION® esiRNA esiRNA targeting mouse Hoxa6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024014 Rosetta Predictions human pricing
XM_001065038 Rosetta Predictions rat pricing
NM_010454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131397 predicted 229
2 SASI_Hs01_00131398 predicted 397
3 SASI_Hs01_00131400 predicted 221
4 SASI_Hs01_00131402 predicted 387
5 SASI_Hs01_00131403 predicted 353
6 SASI_Hs01_00131404 predicted 347
7 SASI_Hs01_00131405 predicted 221
8 SASI_Hs01_00131406 predicted 243
9 SASI_Hs02_00356439 predicted 400
10 SASI_Hs02_00356440 predicted 353
11 SASI_Hs01_00131399 predicted 521
12 SASI_Hs01_00131401 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312640 predicted 229
2 SASI_Rn02_00312641 predicted 255
3 SASI_Rn02_00312642 predicted 283
4 SASI_Rn02_00312643 predicted 255
5 SASI_Rn02_00312644 predicted 258
6 SASI_Rn02_00312645 predicted 876
7 SASI_Rn02_00312646 predicted 864
8 SASI_Rn02_00312647 predicted 191
9 SASI_Rn02_00312648 predicted 860
10 SASI_Rn02_00312649 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158299 predicted 217
2 SASI_Mm01_00158300 predicted 252
3 SASI_Mm01_00158301 predicted 256
4 SASI_Mm01_00158302 predicted 374
5 SASI_Mm01_00158303 predicted 252
6 SASI_Mm01_00158304 predicted 265
7 SASI_Mm01_00158305 predicted 258
8 SASI_Mm01_00158306 predicted 250
9 SASI_Mm01_00158307 predicted 253
10 SASI_Mm01_00158308 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024014
HOXA6 MISSION shRNA Bacterial Glycerol Stock
homeobox A6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-226s1c1
Sequence:CCGGGCCTCGTGTTTCTATTCTGATCTCGAGATCAGAATAGAAACACGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-642s1c1
Sequence:CCGGCAAGCTCATCAATTCCACGCACTCGAGTGCGTGGAATTGATGAGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-388s1c1
Sequence:CCGGCGGAAGTACACGAGCCCGGTTCTCGAGAACCGGGCTCGTGTACTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-150s1c1
Sequence:CCGGGACGTACACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTGTACGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024014.2-79s21c1
Sequence:CCGGCTCTACCAGGCTGGCTATGACCTCGAGGTCATAGCCAGCCTGGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024014.2-167s21c1
Sequence:CCGGGTTTCTACCAACAGTCCAACTCTCGAGAGTTGGACTGTTGGTAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024014
HOXA6 MISSION shRNA shRNA Plasmid DNA
homeobox A6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-226s1c1
Sequence:CCGGGCCTCGTGTTTCTATTCTGATCTCGAGATCAGAATAGAAACACGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-642s1c1
Sequence:CCGGCAAGCTCATCAATTCCACGCACTCGAGTGCGTGGAATTGATGAGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-388s1c1
Sequence:CCGGCGGAAGTACACGAGCCCGGTTCTCGAGAACCGGGCTCGTGTACTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-150s1c1
Sequence:CCGGGACGTACACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTGTACGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024014.2-79s21c1
Sequence:CCGGCTCTACCAGGCTGGCTATGACCTCGAGGTCATAGCCAGCCTGGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024014.2-167s21c1
Sequence:CCGGGTTTCTACCAACAGTCCAACTCTCGAGAGTTGGACTGTTGGTAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024014
HOXA6 MISSION shRNA Lentiviral Transduction Particles
homeobox A6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-226s1c1
Sequence:CCGGGCCTCGTGTTTCTATTCTGATCTCGAGATCAGAATAGAAACACGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-642s1c1
Sequence:CCGGCAAGCTCATCAATTCCACGCACTCGAGTGCGTGGAATTGATGAGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-388s1c1
Sequence:CCGGCGGAAGTACACGAGCCCGGTTCTCGAGAACCGGGCTCGTGTACTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024014.2-150s1c1
Sequence:CCGGGACGTACACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTGTACGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024014.2-79s21c1
Sequence:CCGGCTCTACCAGGCTGGCTATGACCTCGAGGTCATAGCCAGCCTGGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024014.2-167s21c1
Sequence:CCGGGTTTCTACCAACAGTCCAACTCTCGAGAGTTGGACTGTTGGTAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010454
HOXA6 MISSION shRNA Bacterial Glycerol Stock
homeobox A6
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-227s1c1
Sequence:CCGGCCTCATGTTTCTATTCTGATACTCGAGTATCAGAATAGAAACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-387s1c1
Sequence:CCGGGAAGTACACAAGCCCTGTTTACTCGAGTAAACAGGGCTTGTGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-150s1c1
Sequence:CCGGGACATACACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTGTATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-201s1c1
Sequence:CCGGCAACCGGGCATCCTACGAGTACTCGAGTACTCGTAGGATGCCCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010454.1-174s21c1
Sequence:CCGGCCAACAGTCCAACTCGGTCTTCTCGAGAAGACCGAGTTGGACTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010454.1-356s21c1
Sequence:CCGGGCAAAGCCCTCCATGAGGAAGCTCGAGCTTCCTCATGGAGGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010454
HOXA6 MISSION shRNA shRNA Plasmid DNA
homeobox A6
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-227s1c1
Sequence:CCGGCCTCATGTTTCTATTCTGATACTCGAGTATCAGAATAGAAACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-387s1c1
Sequence:CCGGGAAGTACACAAGCCCTGTTTACTCGAGTAAACAGGGCTTGTGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-150s1c1
Sequence:CCGGGACATACACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTGTATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-201s1c1
Sequence:CCGGCAACCGGGCATCCTACGAGTACTCGAGTACTCGTAGGATGCCCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010454.1-174s21c1
Sequence:CCGGCCAACAGTCCAACTCGGTCTTCTCGAGAAGACCGAGTTGGACTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010454.1-356s21c1
Sequence:CCGGGCAAAGCCCTCCATGAGGAAGCTCGAGCTTCCTCATGGAGGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010454
HOXA6 MISSION shRNA Lentiviral Transduction Particles
homeobox A6
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-227s1c1
Sequence:CCGGCCTCATGTTTCTATTCTGATACTCGAGTATCAGAATAGAAACATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-387s1c1
Sequence:CCGGGAAGTACACAAGCCCTGTTTACTCGAGTAAACAGGGCTTGTGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-150s1c1
Sequence:CCGGGACATACACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTGTATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010454.1-201s1c1
Sequence:CCGGCAACCGGGCATCCTACGAGTACTCGAGTACTCGTAGGATGCCCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010454.1-174s21c1
Sequence:CCGGCCAACAGTCCAACTCGGTCTTCTCGAGAAGACCGAGTTGGACTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010454.1-356s21c1
Sequence:CCGGGCAAAGCCCTCCATGAGGAAGCTCGAGCTTCCTCATGGAGGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)