EMAIL THIS PAGE TO A FRIEND

HOXA7

homeobox A7

35 Gene Product Result for
Synonyms: ANTP HOX1 HOX1.1 HOX1A
Gene ID:
Human(3204) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. For example, the encoded protein represses the transcription of differentiation-specific genes during keratinocyte proliferation, but this repression is then overcome by differentiation signals. This gene is highly similar to the antennapedia (Antp) gene of Drosophila. [provided by RefSeq, Jul 2008]
Mouse(15404) homeobox A7
sheep(443359) homeobox A7
chicken(395290) homeobox A7
dog(482371) homeobox A7
cow(615851) homeobox A7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006896 Rosetta Predictions human pricing
NM_010455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141944 predicted 216
2 SASI_Hs01_00141945 predicted 1262
3 SASI_Hs01_00141946 predicted 1202
4 SASI_Hs01_00141947 predicted 217
5 SASI_Hs01_00141948 predicted 1249
6 SASI_Hs01_00141952 predicted 416
7 SASI_Hs01_00141949 predicted 1101
8 SASI_Hs01_00141950 predicted 1024
9 SASI_Hs01_00141951 predicted 137
10 SASI_Hs01_00141953 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164421 predicted 1239
2 SASI_Mm01_00164423 predicted 1315
3 SASI_Mm02_00318631 predicted 1316
4 SASI_Mm01_00164424 predicted 1402
5 SASI_Mm01_00164425 predicted 1470
6 SASI_Mm01_00164426 predicted 1171
7 SASI_Mm01_00164427 predicted 1290
8 SASI_Mm01_00164428 predicted 1312
9 SASI_Mm01_00164430 predicted 1371
10 SASI_Mm02_00318632 predicted 1500
11 SASI_Mm01_00164422 predicted 1321
12 SASI_Mm01_00164429 predicted 1295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010455
HOXA7 MISSION shRNA Bacterial Glycerol Stock
homeobox A7
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1697s21c1
Sequence:CCGGTTCCAGAATCGGCGCATGAAGCTCGAGCTTCATGCGCCGATTCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1323s21c1
Sequence:CCGGCGGGCTTATACAATGTCAACACTCGAGTGTTGACATTGTATAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1504s21c1
Sequence:CCGGCGAAGCCAGTTTCCGCATCTACTCGAGTAGATGCGGAAACTGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1716s21c1
Sequence:GTACCGGAGTGGAAGAAAGAGCATAAAGCTCGAGCTTTATGCTCTTTCTTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1242s21c1
Sequence:CCGGAGCCGACTTCTTGCTCCTTTGCTCGAGCAAAGGAGCAAGAAGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1671s21c1
Sequence:CCGGTCACTGAGCGCCAGATCAAGACTCGAGTCTTGATCTGGCGCTCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1238s1c1
Sequence:CCGGCGAGCCGACTTCTTGCTCCTTCTCGAGAAGGAGCAAGAAGTCGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1502s1c1
Sequence:CCGGCGAAGCCAGTTTCCGCATCTACTCGAGTAGATGCGGAAACTGGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1712s1c1
Sequence:CCGGGAAGTGGAAGAAAGAGCATAACTCGAGTTATGCTCTTTCTTCCACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1537s21c1
Sequence:CCGGCAGTTCAGGACCCGACAGGAACTCGAGTTCCTGTCGGGTCCTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1321s1c1
Sequence:CCGGCGGGCTTATACAATGTCAACACTCGAGTGTTGACATTGTATAAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1781s1c1
Sequence:CCGGCGTTTCCACAGCTGCTGACAACTCGAGTTGTCAGCAGCTGTGGAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1260s21c1
Sequence:CCGGTTGCACCCAACTCGCAGAGAACTCGAGTTCTCTGCGAGTTGGGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1783s21c1
Sequence:CCGGCGTTTCCACAGCTGCTGACAACTCGAGTTGTCAGCAGCTGTGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1609s21c1
Sequence:CCGGATTCCATTTCAACCGCTACCTCTCGAGAGGTAGCGGTTGAAATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1727s21c1
Sequence:CCGGGAGCATAAAGATGAGAGCCAGCTCGAGCTGGCTCTCATCTTTATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010455
HOXA7 MISSION shRNA shRNA Plasmid DNA
homeobox A7
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1697s21c1
Sequence:CCGGTTCCAGAATCGGCGCATGAAGCTCGAGCTTCATGCGCCGATTCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1323s21c1
Sequence:CCGGCGGGCTTATACAATGTCAACACTCGAGTGTTGACATTGTATAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1504s21c1
Sequence:CCGGCGAAGCCAGTTTCCGCATCTACTCGAGTAGATGCGGAAACTGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1716s21c1
Sequence:GTACCGGAGTGGAAGAAAGAGCATAAAGCTCGAGCTTTATGCTCTTTCTTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1242s21c1
Sequence:CCGGAGCCGACTTCTTGCTCCTTTGCTCGAGCAAAGGAGCAAGAAGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1671s21c1
Sequence:CCGGTCACTGAGCGCCAGATCAAGACTCGAGTCTTGATCTGGCGCTCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1238s1c1
Sequence:CCGGCGAGCCGACTTCTTGCTCCTTCTCGAGAAGGAGCAAGAAGTCGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1502s1c1
Sequence:CCGGCGAAGCCAGTTTCCGCATCTACTCGAGTAGATGCGGAAACTGGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1712s1c1
Sequence:CCGGGAAGTGGAAGAAAGAGCATAACTCGAGTTATGCTCTTTCTTCCACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1537s21c1
Sequence:CCGGCAGTTCAGGACCCGACAGGAACTCGAGTTCCTGTCGGGTCCTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1321s1c1
Sequence:CCGGCGGGCTTATACAATGTCAACACTCGAGTGTTGACATTGTATAAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1781s1c1
Sequence:CCGGCGTTTCCACAGCTGCTGACAACTCGAGTTGTCAGCAGCTGTGGAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1260s21c1
Sequence:CCGGTTGCACCCAACTCGCAGAGAACTCGAGTTCTCTGCGAGTTGGGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1783s21c1
Sequence:CCGGCGTTTCCACAGCTGCTGACAACTCGAGTTGTCAGCAGCTGTGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1609s21c1
Sequence:CCGGATTCCATTTCAACCGCTACCTCTCGAGAGGTAGCGGTTGAAATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1727s21c1
Sequence:CCGGGAGCATAAAGATGAGAGCCAGCTCGAGCTGGCTCTCATCTTTATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010455
HOXA7 MISSION shRNA Lentiviral Transduction Particles
homeobox A7
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1697s21c1
Sequence:CCGGTTCCAGAATCGGCGCATGAAGCTCGAGCTTCATGCGCCGATTCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1323s21c1
Sequence:CCGGCGGGCTTATACAATGTCAACACTCGAGTGTTGACATTGTATAAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1504s21c1
Sequence:CCGGCGAAGCCAGTTTCCGCATCTACTCGAGTAGATGCGGAAACTGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1716s21c1
Sequence:GTACCGGAGTGGAAGAAAGAGCATAAAGCTCGAGCTTTATGCTCTTTCTTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1242s21c1
Sequence:CCGGAGCCGACTTCTTGCTCCTTTGCTCGAGCAAAGGAGCAAGAAGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1671s21c1
Sequence:CCGGTCACTGAGCGCCAGATCAAGACTCGAGTCTTGATCTGGCGCTCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1238s1c1
Sequence:CCGGCGAGCCGACTTCTTGCTCCTTCTCGAGAAGGAGCAAGAAGTCGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1502s1c1
Sequence:CCGGCGAAGCCAGTTTCCGCATCTACTCGAGTAGATGCGGAAACTGGCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1712s1c1
Sequence:CCGGGAAGTGGAAGAAAGAGCATAACTCGAGTTATGCTCTTTCTTCCACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1537s21c1
Sequence:CCGGCAGTTCAGGACCCGACAGGAACTCGAGTTCCTGTCGGGTCCTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1321s1c1
Sequence:CCGGCGGGCTTATACAATGTCAACACTCGAGTGTTGACATTGTATAAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010455.1-1781s1c1
Sequence:CCGGCGTTTCCACAGCTGCTGACAACTCGAGTTGTCAGCAGCTGTGGAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1260s21c1
Sequence:CCGGTTGCACCCAACTCGCAGAGAACTCGAGTTCTCTGCGAGTTGGGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1783s21c1
Sequence:CCGGCGTTTCCACAGCTGCTGACAACTCGAGTTGTCAGCAGCTGTGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1609s21c1
Sequence:CCGGATTCCATTTCAACCGCTACCTCTCGAGAGGTAGCGGTTGAAATGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010455.2-1727s21c1
Sequence:CCGGGAGCATAAAGATGAGAGCCAGCTCGAGCTGGCTCTCATCTTTATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006896
HOXA7 MISSION shRNA Bacterial Glycerol Stock
homeobox A7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006896.2-872s1c1
Sequence:CCGGCTTTAAGAGACTCACTGGTTTCTCGAGAAACCAGTGAGTCTCTTAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-285s1c1
Sequence:CCGGTCCGGGCTTATACAATGTCAACTCGAGTTGACATTGTATAAGCCCGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-275s1c1
Sequence:CCGGCCTCGACCGTTCCGGGCTTATCTCGAGATAAGCCCGGAACGGTCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-684s1c1
Sequence:CCGGGTGGAAGAAAGAGCATAAGGACTCGAGTCCTTATGCTCTTTCTTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-498s1c1
Sequence:CCGGGATGCGGTCTTCAGGACCTGACTCGAGTCAGGTCCTGAAGACCGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006896.3-206s21c1
Sequence:CCGGAGCCGACTTCTTGCTCCTTTGCTCGAGCAAAGGAGCAAGAAGTCGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006896.3-1253s21c1
Sequence:CCGGAGACCCGCAAGAAAGTGAATCCTCGAGGATTCACTTTCTTGCGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006896
HOXA7 MISSION shRNA shRNA Plasmid DNA
homeobox A7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006896.2-872s1c1
Sequence:CCGGCTTTAAGAGACTCACTGGTTTCTCGAGAAACCAGTGAGTCTCTTAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-285s1c1
Sequence:CCGGTCCGGGCTTATACAATGTCAACTCGAGTTGACATTGTATAAGCCCGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-275s1c1
Sequence:CCGGCCTCGACCGTTCCGGGCTTATCTCGAGATAAGCCCGGAACGGTCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-684s1c1
Sequence:CCGGGTGGAAGAAAGAGCATAAGGACTCGAGTCCTTATGCTCTTTCTTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-498s1c1
Sequence:CCGGGATGCGGTCTTCAGGACCTGACTCGAGTCAGGTCCTGAAGACCGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006896.3-206s21c1
Sequence:CCGGAGCCGACTTCTTGCTCCTTTGCTCGAGCAAAGGAGCAAGAAGTCGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006896.3-1253s21c1
Sequence:CCGGAGACCCGCAAGAAAGTGAATCCTCGAGGATTCACTTTCTTGCGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006896
HOXA7 MISSION shRNA Lentiviral Transduction Particles
homeobox A7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006896.2-872s1c1
Sequence:CCGGCTTTAAGAGACTCACTGGTTTCTCGAGAAACCAGTGAGTCTCTTAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-285s1c1
Sequence:CCGGTCCGGGCTTATACAATGTCAACTCGAGTTGACATTGTATAAGCCCGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-275s1c1
Sequence:CCGGCCTCGACCGTTCCGGGCTTATCTCGAGATAAGCCCGGAACGGTCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-684s1c1
Sequence:CCGGGTGGAAGAAAGAGCATAAGGACTCGAGTCCTTATGCTCTTTCTTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006896.2-498s1c1
Sequence:CCGGGATGCGGTCTTCAGGACCTGACTCGAGTCAGGTCCTGAAGACCGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006896.3-206s21c1
Sequence:CCGGAGCCGACTTCTTGCTCCTTTGCTCGAGCAAAGGAGCAAGAAGTCGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006896.3-1253s21c1
Sequence:CCGGAGACCCGCAAGAAAGTGAATCCTCGAGGATTCACTTTCTTGCGGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)