EMAIL THIS PAGE TO A FRIEND

HOXA9

homeobox A9

96 Gene Product Result for
Synonyms: ABD-B HOX1 HOX1.7 HOX1G
UniProtKB ID: P31269, O43369, O43429, Q99820
Gene ID:
Human(3205) Summary: In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. This gene is highly similar to the abdominal-B (Abd-B) gene of Drosophila. A specific translocation event which causes a fusion between this gene and the NUP98 gene has been associated with myeloid leukemogenesis. Read-through transcription exists between this gene and the upstream homeobox A10 (HOXA10) gene.[provided by RefSeq, Mar 2011]
Mouse(15405) homeobox A9
Rat(500126) homeobox A9
chicken(396096) homeobox A9
cow(510459) homeobox A9
dog(482372) homeobox A9
sheep(101105652) homeobox A9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152739 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077831 MISSION® esiRNA esiRNA human HOXA9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152739 Rosetta Predictions human pricing
NM_001109233 Rosetta Predictions rat pricing
NM_010456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134929 predicted 256
2 SASI_Hs01_00134930 predicted 508
3 SASI_Hs01_00134931 predicted 524
4 SASI_Hs01_00134932 predicted 497
5 SASI_Hs01_00134933 predicted 455
6 SASI_Hs01_00134937 predicted 306
7 SASI_Hs01_00134935 predicted 768
8 SASI_Hs01_00134936 predicted 642
9 SASI_Hs01_00134934 predicted 887
10 SASI_Hs01_00134938 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246394 predicted 253
2 SASI_Rn02_00246395 predicted 246
3 SASI_Rn02_00246396 predicted 241
4 SASI_Rn02_00246397 predicted 335
5 SASI_Rn02_00246398 predicted 248
6 SASI_Rn02_00246399 predicted 247
7 SASI_Rn02_00246400 predicted 462
8 SASI_Rn02_00246401 predicted 426
9 SASI_Rn02_00246402 predicted 333
10 SASI_Rn02_00246403 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021182 predicted 1699
2 SASI_Mm02_00318633 predicted 1710
3 SASI_Mm01_00021183 predicted 1686
4 SASI_Mm01_00021184 predicted 1637
5 SASI_Mm01_00021185 predicted 1448
6 SASI_Mm02_00318634 predicted 1418
7 SASI_Mm01_00021188 predicted 1432
8 SASI_Mm01_00021189 predicted 1645
9 SASI_Mm01_00021190 predicted 1724
10 SASI_Mm01_00021191 predicted 1862
11 SASI_Mm01_00021186 predicted 1878
12 SASI_Mm01_00021187 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002142
VALIDATED
HOXA9 MISSION shRNA Bacterial Glycerol Stock
homeobox A9
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000015163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-1460s1c1
Sequence:CCGGCGGGCATTTAAGTCTGTCCATCTCGAGATGGACAGACTTAAATGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-242s1c1
Sequence:CCGGCAGTCCAAGGCGACGGTGTTTCTCGAGAAACACCGTCGCCTTGGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-265s1c1
Sequence:CCGGCGCCTCGTGGAACCCAGTGCACTCGAGTGCACTGGGTTCCACGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-301s1c1
Sequence:CCGGCGCTGTACCCGCTGCGGTGTACTCGAGTACACCGCAGCGGGTACAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002142
VALIDATED
HOXA9 MISSION shRNA shRNA Plasmid DNA
homeobox A9
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000015163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-1460s1c1
Sequence:CCGGCGGGCATTTAAGTCTGTCCATCTCGAGATGGACAGACTTAAATGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-242s1c1
Sequence:CCGGCAGTCCAAGGCGACGGTGTTTCTCGAGAAACACCGTCGCCTTGGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-265s1c1
Sequence:CCGGCGCCTCGTGGAACCCAGTGCACTCGAGTGCACTGGGTTCCACGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-301s1c1
Sequence:CCGGCGCTGTACCCGCTGCGGTGTACTCGAGTACACCGCAGCGGGTACAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002142
VALIDATED
HOXA9 MISSION shRNA Lentiviral Transduction Particles
homeobox A9
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000015163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-1460s1c1
Sequence:CCGGCGGGCATTTAAGTCTGTCCATCTCGAGATGGACAGACTTAAATGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-242s1c1
Sequence:CCGGCAGTCCAAGGCGACGGTGTTTCTCGAGAAACACCGTCGCCTTGGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-265s1c1
Sequence:CCGGCGCCTCGTGGAACCCAGTGCACTCGAGTGCACTGGGTTCCACGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002142.3-301s1c1
Sequence:CCGGCGCTGTACCCGCTGCGGTGTACTCGAGTACACCGCAGCGGGTACAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010456
VALIDATED
HOXA9 MISSION shRNA Bacterial Glycerol Stock
homeobox A9
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010456.1-1655s1c1
Sequence:CCGGGCATTAAACCTGAACCGCTCTCTCGAGAGAGCGGTTCAGGTTTAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1886s1c1
Sequence:CCGGAGAAGCGATGCCCTTACACAACTCGAGTTGTGTAAGGGCATCGCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1739s1c1
Sequence:CCGGGTGGTTCTCCTCCAGTTGATACTCGAGTATCAACTGGAGGAGAACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1698s1c1
Sequence:CCGGCACGCTTGACACTCACACTTTCTCGAGAAAGTGTGAGTGTCAAGCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010456.1-2106s1c1
Sequence:CCGGAGAGAGCAAGCTAGAAAGAAACTCGAGTTTCTTTCTAGCTTGCTCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1650s21c1
Sequence:CCGGTTATGGCATTAAACCTGAACCCTCGAGGGTTCAGGTTTAATGCCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1414s21c1
Sequence:CCGGGACTTCAGTCCTTGCAGCTTCCTCGAGGAAGCTGCAAGGACTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1292s21c1
Sequence:CCGGACTACTATGTGGACTCCTTCCCTCGAGGGAAGGAGTCCACATAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1869s21c1
Sequence:CCGGTGCTCGCTCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGAGCGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1940s21c1
Sequence:CCGGTGTTTAACATGTACCTCACACCTCGAGGTGTGAGGTACATGTTAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1582s21c1
Sequence:CCGGTATATGCGCTCCTGGCTGGAACTCGAGTTCCAGCCAGGAGCGCATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010456
VALIDATED
HOXA9 MISSION shRNA shRNA Plasmid DNA
homeobox A9
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010456.1-1655s1c1
Sequence:CCGGGCATTAAACCTGAACCGCTCTCTCGAGAGAGCGGTTCAGGTTTAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1886s1c1
Sequence:CCGGAGAAGCGATGCCCTTACACAACTCGAGTTGTGTAAGGGCATCGCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1739s1c1
Sequence:CCGGGTGGTTCTCCTCCAGTTGATACTCGAGTATCAACTGGAGGAGAACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1698s1c1
Sequence:CCGGCACGCTTGACACTCACACTTTCTCGAGAAAGTGTGAGTGTCAAGCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010456.1-2106s1c1
Sequence:CCGGAGAGAGCAAGCTAGAAAGAAACTCGAGTTTCTTTCTAGCTTGCTCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1650s21c1
Sequence:CCGGTTATGGCATTAAACCTGAACCCTCGAGGGTTCAGGTTTAATGCCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1414s21c1
Sequence:CCGGGACTTCAGTCCTTGCAGCTTCCTCGAGGAAGCTGCAAGGACTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1292s21c1
Sequence:CCGGACTACTATGTGGACTCCTTCCCTCGAGGGAAGGAGTCCACATAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1869s21c1
Sequence:CCGGTGCTCGCTCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGAGCGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1940s21c1
Sequence:CCGGTGTTTAACATGTACCTCACACCTCGAGGTGTGAGGTACATGTTAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1582s21c1
Sequence:CCGGTATATGCGCTCCTGGCTGGAACTCGAGTTCCAGCCAGGAGCGCATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010456
VALIDATED
HOXA9 MISSION shRNA Lentiviral Transduction Particles
homeobox A9
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010456.1-1655s1c1
Sequence:CCGGGCATTAAACCTGAACCGCTCTCTCGAGAGAGCGGTTCAGGTTTAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1886s1c1
Sequence:CCGGAGAAGCGATGCCCTTACACAACTCGAGTTGTGTAAGGGCATCGCTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1739s1c1
Sequence:CCGGGTGGTTCTCCTCCAGTTGATACTCGAGTATCAACTGGAGGAGAACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010456.1-1698s1c1
Sequence:CCGGCACGCTTGACACTCACACTTTCTCGAGAAAGTGTGAGTGTCAAGCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010456.1-2106s1c1
Sequence:CCGGAGAGAGCAAGCTAGAAAGAAACTCGAGTTTCTTTCTAGCTTGCTCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1650s21c1
Sequence:CCGGTTATGGCATTAAACCTGAACCCTCGAGGGTTCAGGTTTAATGCCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1414s21c1
Sequence:CCGGGACTTCAGTCCTTGCAGCTTCCTCGAGGAAGCTGCAAGGACTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1292s21c1
Sequence:CCGGACTACTATGTGGACTCCTTCCCTCGAGGGAAGGAGTCCACATAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1869s21c1
Sequence:CCGGTGCTCGCTCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGAGCGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1940s21c1
Sequence:CCGGTGTTTAACATGTACCTCACACCTCGAGGTGTGAGGTACATGTTAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010456.2-1582s21c1
Sequence:CCGGTATATGCGCTCCTGGCTGGAACTCGAGTTCCAGCCAGGAGCGCATATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152739
VALIDATED
HOXA9 MISSION shRNA Bacterial Glycerol Stock
homeobox A9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152739.3-509s21c1
Sequence:CCGGACGCTTGACACTCACACTTTGCTCGAGCAAAGTGTGAGTGTCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152739.3-458s21c1
Sequence:CCGGCCTTATGGCATTAAACCTGAACTCGAGTTCAGGTTTAATGCCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-1838s21c1
Sequence:CCGGTGCTGATTGTAACGGAGTTAACTCGAGTTAACTCCGTTACAATCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-550s21c1
Sequence:CCGGTGGTTCTCCTCCAGTTGATAGCTCGAGCTATCAACTGGAGGAGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-891s21c1
Sequence:CCGGGATGCCATTTGGGCTTATTTACTCGAGTAAATAAGCCCAAATGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152739
VALIDATED
HOXA9 MISSION shRNA shRNA Plasmid DNA
homeobox A9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152739.3-509s21c1
Sequence:CCGGACGCTTGACACTCACACTTTGCTCGAGCAAAGTGTGAGTGTCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152739.3-458s21c1
Sequence:CCGGCCTTATGGCATTAAACCTGAACTCGAGTTCAGGTTTAATGCCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-1838s21c1
Sequence:CCGGTGCTGATTGTAACGGAGTTAACTCGAGTTAACTCCGTTACAATCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-550s21c1
Sequence:CCGGTGGTTCTCCTCCAGTTGATAGCTCGAGCTATCAACTGGAGGAGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-891s21c1
Sequence:CCGGGATGCCATTTGGGCTTATTTACTCGAGTAAATAAGCCCAAATGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152739
VALIDATED
HOXA9 MISSION shRNA Lentiviral Transduction Particles
homeobox A9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152739.3-509s21c1
Sequence:CCGGACGCTTGACACTCACACTTTGCTCGAGCAAAGTGTGAGTGTCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152739.3-458s21c1
Sequence:CCGGCCTTATGGCATTAAACCTGAACTCGAGTTCAGGTTTAATGCCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-1838s21c1
Sequence:CCGGTGCTGATTGTAACGGAGTTAACTCGAGTTAACTCCGTTACAATCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-550s21c1
Sequence:CCGGTGGTTCTCCTCCAGTTGATAGCTCGAGCTATCAACTGGAGGAGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152739.3-891s21c1
Sequence:CCGGGATGCCATTTGGGCTTATTTACTCGAGTAAATAAGCCCAAATGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)