EMAIL THIS PAGE TO A FRIEND

HOXB13

homeobox B13

51 Gene Product Result for
Synonyms: PSGD
UniProtKB ID: Q92826, B2R878, Q96QM4, Q99810
Gene ID:
Human(10481) Summary: This gene encodes a transcription factor that belongs to the homeobox gene family. Genes of this family are highly conserved among vertebrates and essential for vertebrate embryonic development. This gene has been implicated to play a role in fetal skin development and cutaneous regeneration. In mice, a similar gene was shown to exhibit temporal and spatial colinearity in the main body axis of the embryo, but was not expressed in the secondary axes, which suggests functions in body patterning along the axis. This gene and other HOXB genes form a gene cluster at chromosome the 17q21-22 region. [provided by RefSeq, Jul 2008]
Mouse(15408) homeobox B13
Rat(303480) homeo box B13
chicken(771676) homeobox B13
cow(539688) homeobox B13
dog(491060) homeobox B13
sheep(101114626) homeobox B13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006361 Rosetta Predictions human pricing
NM_001107041 Rosetta Predictions rat pricing
NM_008267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032419 predicted 784
2 SASI_Hs01_00032420 predicted 887
3 SASI_Hs01_00032421 predicted 1359
4 SASI_Hs02_00341418 predicted 1353
5 SASI_Hs01_00032422 predicted 1256
6 SASI_Hs01_00032423 predicted 273
7 SASI_Hs01_00032424 predicted 1364
8 SASI_Hs01_00032426 predicted 547
9 SASI_Hs01_00032427 predicted 1228
10 SASI_Hs02_00341419 predicted 1303
11 SASI_Hs01_00032425 predicted 697
12 SASI_Hs01_00032428 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224906 predicted 659
2 SASI_Rn02_00224907 predicted 826
3 SASI_Rn02_00224908 predicted 881
4 SASI_Rn02_00224909 predicted 860
5 SASI_Rn02_00224910 predicted 817
6 SASI_Rn02_00224911 predicted 292
7 SASI_Rn02_00224912 predicted 439
8 SASI_Rn02_00224913 predicted 600
9 SASI_Rn02_00224914 predicted 371
10 SASI_Rn02_00224915 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176406 predicted 850
2 SASI_Mm01_00176407 predicted 627
3 SASI_Mm01_00176408 predicted 394
4 SASI_Mm01_00176409 predicted 785
5 SASI_Mm01_00176410 predicted 821
6 SASI_Mm01_00176411 predicted 205
7 SASI_Mm01_00176412 predicted 341
8 SASI_Mm01_00176413 predicted 497
9 SASI_Mm01_00176414 predicted 326
10 SASI_Mm01_00176415 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008267
VALIDATED
HOXB13 MISSION shRNA Bacterial Glycerol Stock
homeobox B13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-455s1c1
Sequence:CCGGCCCACCGAGTTTGCCTTCTATCTCGAGATAGAAGGCAAACTCGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008267.3-1142s21c1
Sequence:CCGGCTGTATCAGTCATAATCATTCCTCGAGGAATGATTATGACTGATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-360s21c1
Sequence:CCGGTATCCAGGAGCTCCCTGAAACCTCGAGGTTTCAGGGAGCTCCTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-794s1c1
Sequence:CCGGGCAGCCAACAAGTTTATCACTCTCGAGAGTGATAAACTTGTTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-208s1c1
Sequence:CCGGGCTGATGCCAACTGTCAACTACTCGAGTAGTTGACAGTTGGCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-904s1c1
Sequence:CCGGGAAGGTTCTTGCCAAGGTCAACTCGAGTTGACCTTGGCAAGAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-849s1c1
Sequence:CCGGGCCTCTCTGAACGCCAGATTACTCGAGTAATCTGGCGTTCAGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-328s21c1
Sequence:CCGGCTACTTTGGAGGCGGGTACTACTCGAGTAGTACCCGCCTCCAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-404s21c1
Sequence:CCGGGCTACCTACCCTTCGGAAACTCTCGAGAGTTTCCGAAGGGTAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-663s21c1
Sequence:CCGGCATTCTGGAAAGCAGCGTTTGCTCGAGCAAACGCTGCTTTCCAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008267
VALIDATED
HOXB13 MISSION shRNA shRNA Plasmid DNA
homeobox B13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-455s1c1
Sequence:CCGGCCCACCGAGTTTGCCTTCTATCTCGAGATAGAAGGCAAACTCGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008267.3-1142s21c1
Sequence:CCGGCTGTATCAGTCATAATCATTCCTCGAGGAATGATTATGACTGATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-360s21c1
Sequence:CCGGTATCCAGGAGCTCCCTGAAACCTCGAGGTTTCAGGGAGCTCCTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-794s1c1
Sequence:CCGGGCAGCCAACAAGTTTATCACTCTCGAGAGTGATAAACTTGTTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-208s1c1
Sequence:CCGGGCTGATGCCAACTGTCAACTACTCGAGTAGTTGACAGTTGGCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-904s1c1
Sequence:CCGGGAAGGTTCTTGCCAAGGTCAACTCGAGTTGACCTTGGCAAGAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-849s1c1
Sequence:CCGGGCCTCTCTGAACGCCAGATTACTCGAGTAATCTGGCGTTCAGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-328s21c1
Sequence:CCGGCTACTTTGGAGGCGGGTACTACTCGAGTAGTACCCGCCTCCAAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-404s21c1
Sequence:CCGGGCTACCTACCCTTCGGAAACTCTCGAGAGTTTCCGAAGGGTAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-663s21c1
Sequence:CCGGCATTCTGGAAAGCAGCGTTTGCTCGAGCAAACGCTGCTTTCCAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008267
VALIDATED
HOXB13 MISSION shRNA Lentiviral Transduction Particles
homeobox B13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-455s1c1
Sequence:CCGGCCCACCGAGTTTGCCTTCTATCTCGAGATAGAAGGCAAACTCGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271131    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008267.3-1142s21c1
Sequence:CCGGCTGTATCAGTCATAATCATTCCTCGAGGAATGATTATGACTGATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-360s21c1
Sequence:CCGGTATCCAGGAGCTCCCTGAAACCTCGAGGTTTCAGGGAGCTCCTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-794s1c1
Sequence:CCGGGCAGCCAACAAGTTTATCACTCTCGAGAGTGATAAACTTGTTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-208s1c1
Sequence:CCGGGCTGATGCCAACTGTCAACTACTCGAGTAGTTGACAGTTGGCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-904s1c1
Sequence:CCGGGAAGGTTCTTGCCAAGGTCAACTCGAGTTGACCTTGGCAAGAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008267.2-849s1c1
Sequence:CCGGGCCTCTCTGAACGCCAGATTACTCGAGTAATCTGGCGTTCAGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-328s21c1
Sequence:CCGGCTACTTTGGAGGCGGGTACTACTCGAGTAGTACCCGCCTCCAAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-404s21c1
Sequence:CCGGGCTACCTACCCTTCGGAAACTCTCGAGAGTTTCCGAAGGGTAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008267.3-663s21c1
Sequence:CCGGCATTCTGGAAAGCAGCGTTTGCTCGAGCAAACGCTGCTTTCCAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006361
VALIDATED
HOXB13 MISSION shRNA Bacterial Glycerol Stock
homeobox B13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-281s21c1
Sequence:CCGGTGATGCCTGCTGTCAACTATGCTCGAGCATAGTTGACAGCAGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-359s1c1
Sequence:CCGGCCCGTGCCTTATGGTTACTTTCTCGAGAAAGTAACCATAAGGCACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-508s1c1
Sequence:CCGGGTTTGCCTTCTATCCGGGATACTCGAGTATCCCGGATAGAAGGCAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-882s21c1
Sequence:CCGGCAAGGACAAGAGGCGCAAGATCTCGAGATCTTGCGCCTCTTGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-997s1c1
Sequence:CCGGGCCTGGGTGGGAGGAGCGAAACTCGAGTTTCGCTCCTCCCACCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006361.2-624s1c1
Sequence:CCGGCTGTGGACAGTTACCAGTCTTCTCGAGAAGACTGGTAACTGTCCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-902s1c1
Sequence:CCGGCGCCAGATTACCATCTGGTTTCTCGAGAAACCAGATGGTAATCTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006361.5-1306s21c1
Sequence:CCGGATGATCGTTAGCCTCATATTTCTCGAGAAATATGAGGCTAACGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-385s21c1
Sequence:CCGGCCCGTGCCTTATGGTTACTTTCTCGAGAAAGTAACCATAAGGCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006361
VALIDATED
HOXB13 MISSION shRNA shRNA Plasmid DNA
homeobox B13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-281s21c1
Sequence:CCGGTGATGCCTGCTGTCAACTATGCTCGAGCATAGTTGACAGCAGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-359s1c1
Sequence:CCGGCCCGTGCCTTATGGTTACTTTCTCGAGAAAGTAACCATAAGGCACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-508s1c1
Sequence:CCGGGTTTGCCTTCTATCCGGGATACTCGAGTATCCCGGATAGAAGGCAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-882s21c1
Sequence:CCGGCAAGGACAAGAGGCGCAAGATCTCGAGATCTTGCGCCTCTTGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-997s1c1
Sequence:CCGGGCCTGGGTGGGAGGAGCGAAACTCGAGTTTCGCTCCTCCCACCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006361.2-624s1c1
Sequence:CCGGCTGTGGACAGTTACCAGTCTTCTCGAGAAGACTGGTAACTGTCCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-902s1c1
Sequence:CCGGCGCCAGATTACCATCTGGTTTCTCGAGAAACCAGATGGTAATCTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006361.5-1306s21c1
Sequence:CCGGATGATCGTTAGCCTCATATTTCTCGAGAAATATGAGGCTAACGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-385s21c1
Sequence:CCGGCCCGTGCCTTATGGTTACTTTCTCGAGAAAGTAACCATAAGGCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006361
VALIDATED
HOXB13 MISSION shRNA Lentiviral Transduction Particles
homeobox B13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-281s21c1
Sequence:CCGGTGATGCCTGCTGTCAACTATGCTCGAGCATAGTTGACAGCAGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-359s1c1
Sequence:CCGGCCCGTGCCTTATGGTTACTTTCTCGAGAAAGTAACCATAAGGCACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-508s1c1
Sequence:CCGGGTTTGCCTTCTATCCGGGATACTCGAGTATCCCGGATAGAAGGCAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-882s21c1
Sequence:CCGGCAAGGACAAGAGGCGCAAGATCTCGAGATCTTGCGCCTCTTGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-997s1c1
Sequence:CCGGGCCTGGGTGGGAGGAGCGAAACTCGAGTTTCGCTCCTCCCACCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006361.2-624s1c1
Sequence:CCGGCTGTGGACAGTTACCAGTCTTCTCGAGAAGACTGGTAACTGTCCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006361.2-902s1c1
Sequence:CCGGCGCCAGATTACCATCTGGTTTCTCGAGAAACCAGATGGTAATCTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006361.5-1306s21c1
Sequence:CCGGATGATCGTTAGCCTCATATTTCTCGAGAAATATGAGGCTAACGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006361.5-385s21c1
Sequence:CCGGCCCGTGCCTTATGGTTACTTTCTCGAGAAAGTAACCATAAGGCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)