EMAIL THIS PAGE TO A FRIEND

HOXB1

homeobox B1

73 Gene Product Result for
Synonyms: HCFP3 HOX2 HOX2I Hox-2.9
UniProtKB ID: P14653
Gene ID:
Human(3211) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXB genes located in a cluster on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(15407) homeobox B1
Rat(303491) homeo box B1
chicken(395900) homeobox B1
cow(528429) homeobox B1
dog(491052) homeobox B1
sheep(101115633) homeobox B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002144 Rosetta Predictions human pricing
XM_001081344 Rosetta Predictions rat pricing
XM_220896 Rosetta Predictions rat pricing
NM_008266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174349 predicted 489
2 SASI_Hs01_00174350 predicted 566
3 SASI_Hs01_00174351 predicted 535
4 SASI_Hs01_00174352 predicted 541
5 SASI_Hs01_00174354 predicted 473
6 SASI_Hs01_00174355 predicted 469
7 SASI_Hs01_00174356 predicted 409
8 SASI_Hs01_00174357 predicted 450
9 SASI_Hs01_00174358 predicted 316
10 SASI_Hs02_00333326 predicted 276
11 SASI_Hs01_00174353 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371544 predicted 256
2 SASI_Rn02_00371545 predicted 448
3 SASI_Rn02_00371546 predicted 393
4 SASI_Rn02_00371547 predicted 437
5 SASI_Rn02_00371548 predicted 516
6 SASI_Rn02_00371549 predicted 257
7 SASI_Rn02_00371550 predicted 418
8 SASI_Rn02_00371551 predicted 417
9 SASI_Rn02_00371552 predicted 414
10 SASI_Rn02_00371553 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379619 predicted 720
2 SASI_Rn02_00379620 predicted 747
3 SASI_Rn02_00379621 predicted 662
4 SASI_Rn02_00379622 predicted 692
5 SASI_Rn02_00379623 predicted 709
6 SASI_Rn02_00379624 predicted 785
7 SASI_Rn02_00379625 predicted 795
8 SASI_Rn02_00379626 predicted 699
9 SASI_Rn02_00379627 predicted 695
10 SASI_Rn02_00379628 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047864 predicted 331
2 SASI_Mm01_00047865 predicted 503
3 SASI_Mm01_00047866 predicted 594
4 SASI_Mm01_00047867 predicted 1062
5 SASI_Mm01_00047868 predicted 492
6 SASI_Mm01_00047869 predicted 554
7 SASI_Mm01_00047870 predicted 626
8 SASI_Mm01_00047872 predicted 540
9 SASI_Mm01_00047873 predicted 705
10 SASI_Mm02_00313494 predicted 1005
11 SASI_Mm01_00047871 predicted 1254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002144
HOXB1 MISSION shRNA Bacterial Glycerol Stock
homeobox B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-283s21c1
Sequence:CCGGTACGGGCCTTCTCAGTACTACCTCGAGGTAGTACTGAGAAGGCCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-508s21c1
Sequence:CCGGTGCCCTTCAGAACCTAACACCCTCGAGGGTGTTAGGTTCTGAAGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-318s21c1
Sequence:CCGGAGAAGGAGACGGAGGCTATTTCTCGAGAAATAGCCTCCGTCTCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-729s1c1
Sequence:CCGGGCTCAATGAAACACAGGTCAACTCGAGTTGACCTGTGTTTCATTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-765s1c1
Sequence:CCGGCCGACGAATGAAGCAGAAGAACTCGAGTTCTTCTGCTTCATTCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-454s1c1
Sequence:CCGGGCGAGCTTTGCACCGGCCTATCTCGAGATAGGCCGGTGCAAAGCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-167s1c1
Sequence:CCGGGCCCTGCGTTTCAGCAGAACTCTCGAGAGTTCTGCTGAAACGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-543s1c1
Sequence:CCGGCTTCGACTGGATGAAGGTTAACTCGAGTTAACCTTCATCCAGTCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002144
HOXB1 MISSION shRNA shRNA Plasmid DNA
homeobox B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-283s21c1
Sequence:CCGGTACGGGCCTTCTCAGTACTACCTCGAGGTAGTACTGAGAAGGCCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-508s21c1
Sequence:CCGGTGCCCTTCAGAACCTAACACCCTCGAGGGTGTTAGGTTCTGAAGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-318s21c1
Sequence:CCGGAGAAGGAGACGGAGGCTATTTCTCGAGAAATAGCCTCCGTCTCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-729s1c1
Sequence:CCGGGCTCAATGAAACACAGGTCAACTCGAGTTGACCTGTGTTTCATTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-765s1c1
Sequence:CCGGCCGACGAATGAAGCAGAAGAACTCGAGTTCTTCTGCTTCATTCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-454s1c1
Sequence:CCGGGCGAGCTTTGCACCGGCCTATCTCGAGATAGGCCGGTGCAAAGCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-167s1c1
Sequence:CCGGGCCCTGCGTTTCAGCAGAACTCTCGAGAGTTCTGCTGAAACGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-543s1c1
Sequence:CCGGCTTCGACTGGATGAAGGTTAACTCGAGTTAACCTTCATCCAGTCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002144
HOXB1 MISSION shRNA Lentiviral Transduction Particles
homeobox B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-283s21c1
Sequence:CCGGTACGGGCCTTCTCAGTACTACCTCGAGGTAGTACTGAGAAGGCCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-508s21c1
Sequence:CCGGTGCCCTTCAGAACCTAACACCCTCGAGGGTGTTAGGTTCTGAAGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002144.3-318s21c1
Sequence:CCGGAGAAGGAGACGGAGGCTATTTCTCGAGAAATAGCCTCCGTCTCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-729s1c1
Sequence:CCGGGCTCAATGAAACACAGGTCAACTCGAGTTGACCTGTGTTTCATTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-765s1c1
Sequence:CCGGCCGACGAATGAAGCAGAAGAACTCGAGTTCTTCTGCTTCATTCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-454s1c1
Sequence:CCGGGCGAGCTTTGCACCGGCCTATCTCGAGATAGGCCGGTGCAAAGCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-167s1c1
Sequence:CCGGGCCCTGCGTTTCAGCAGAACTCTCGAGAGTTCTGCTGAAACGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002144.2-543s1c1
Sequence:CCGGCTTCGACTGGATGAAGGTTAACTCGAGTTAACCTTCATCCAGTCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008266
VALIDATED
HOXB1 MISSION shRNA Bacterial Glycerol Stock
homeobox B1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-962s21c1
Sequence:CCGGGAATTGAACTTCCTAAGTAACCTCGAGGTTACTTAGGAAGTTCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-372s21c1
Sequence:CCGGGGAAGGAGATGGAAGCTATTTCTCGAGAAATAGCTTCCATCTCCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-550s21c1
Sequence:CCGGGAATCGCCTTGCTCGTCAGAACTCGAGTTCTGACGAGCAAGGCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-771s21c1
Sequence:CCGGCACCCTGGAGCTCAATGAAACCTCGAGGTTTCATTGAGCTCCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008266.4-1001s21c1
Sequence:CCGGCCAGTTCTCTCGAAGACTTTCCTCGAGGAAAGTCTTCGAGAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-337s1c1
Sequence:CCGGCTATGGGCCTTCTCAGTATTACTCGAGTAATACTGAGAAGGCCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-595s1c1
Sequence:CCGGCTTCGACTGGATGAAGGTCAACTCGAGTTGACCTTCATCCAGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-781s1c1
Sequence:CCGGGCTCAATGAAACGCAGGTGAACTCGAGTTCACCTGCGTTTCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-622s1c1
Sequence:CCGGCCCACCTAAGACAGCGAAGGTCTCGAGACCTTCGCTGTCTTAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-372s1c1
Sequence:CCGGCGGAAGGAGATGGAAGCTATTCTCGAGAATAGCTTCCATCTCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008266
VALIDATED
HOXB1 MISSION shRNA shRNA Plasmid DNA
homeobox B1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-962s21c1
Sequence:CCGGGAATTGAACTTCCTAAGTAACCTCGAGGTTACTTAGGAAGTTCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-372s21c1
Sequence:CCGGGGAAGGAGATGGAAGCTATTTCTCGAGAAATAGCTTCCATCTCCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-550s21c1
Sequence:CCGGGAATCGCCTTGCTCGTCAGAACTCGAGTTCTGACGAGCAAGGCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-771s21c1
Sequence:CCGGCACCCTGGAGCTCAATGAAACCTCGAGGTTTCATTGAGCTCCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008266.4-1001s21c1
Sequence:CCGGCCAGTTCTCTCGAAGACTTTCCTCGAGGAAAGTCTTCGAGAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-337s1c1
Sequence:CCGGCTATGGGCCTTCTCAGTATTACTCGAGTAATACTGAGAAGGCCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-595s1c1
Sequence:CCGGCTTCGACTGGATGAAGGTCAACTCGAGTTGACCTTCATCCAGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-781s1c1
Sequence:CCGGGCTCAATGAAACGCAGGTGAACTCGAGTTCACCTGCGTTTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-622s1c1
Sequence:CCGGCCCACCTAAGACAGCGAAGGTCTCGAGACCTTCGCTGTCTTAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-372s1c1
Sequence:CCGGCGGAAGGAGATGGAAGCTATTCTCGAGAATAGCTTCCATCTCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008266
VALIDATED
HOXB1 MISSION shRNA Lentiviral Transduction Particles
homeobox B1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-962s21c1
Sequence:CCGGGAATTGAACTTCCTAAGTAACCTCGAGGTTACTTAGGAAGTTCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-372s21c1
Sequence:CCGGGGAAGGAGATGGAAGCTATTTCTCGAGAAATAGCTTCCATCTCCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-550s21c1
Sequence:CCGGGAATCGCCTTGCTCGTCAGAACTCGAGTTCTGACGAGCAAGGCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008266.4-771s21c1
Sequence:CCGGCACCCTGGAGCTCAATGAAACCTCGAGGTTTCATTGAGCTCCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008266.4-1001s21c1
Sequence:CCGGCCAGTTCTCTCGAAGACTTTCCTCGAGGAAAGTCTTCGAGAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-337s1c1
Sequence:CCGGCTATGGGCCTTCTCAGTATTACTCGAGTAATACTGAGAAGGCCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-595s1c1
Sequence:CCGGCTTCGACTGGATGAAGGTCAACTCGAGTTGACCTTCATCCAGTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-781s1c1
Sequence:CCGGGCTCAATGAAACGCAGGTGAACTCGAGTTCACCTGCGTTTCATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-622s1c1
Sequence:CCGGCCCACCTAAGACAGCGAAGGTCTCGAGACCTTCGCTGTCTTAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008266.3-372s1c1
Sequence:CCGGCGGAAGGAGATGGAAGCTATTCTCGAGAATAGCTTCCATCTCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)