EMAIL THIS PAGE TO A FRIEND

HOXB3

homeobox B3

135 Gene Product Result for
Synonyms: HOX2 HOX2G Hox-2.7
UniProtKB ID: P14651, A8K567, D3DTV3, O95615, P17484
Gene ID:
Human(3213) Summary: This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with a distinct biologic subset of acute myeloid leukemia (AML). [provided by RefSeq, Jul 2008]
Mouse(15410) homeobox B3
Rat(303488) homeo box B3
chicken(395502) homeobox B3
cow(618214) homeobox B3
dog(491054) homeobox B3
sheep(101121109) homeobox B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002146 Rosetta Predictions human pricing
NM_001107042 Rosetta Predictions rat pricing
NM_001079869 Rosetta Predictions mouse pricing
NM_010458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211719 predicted 2127
2 SASI_Hs01_00211720 predicted 2115
3 SASI_Hs01_00211722 predicted 1972
4 SASI_Hs01_00211723 predicted 2208
5 SASI_Hs01_00211724 predicted 1659
6 SASI_Hs02_00333329 predicted 1673
7 SASI_Hs01_00211725 predicted 1836
8 SASI_Hs01_00211726 predicted 2247
9 SASI_Hs02_00333330 predicted 2133
10 SASI_Hs02_00333331 predicted 2118
11 SASI_Hs01_00211718 predicted 1961
12 SASI_Hs01_00211721 predicted 2248
13 SASI_Hs01_00211727 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224916 predicted 1365
2 SASI_Rn02_00224917 predicted 1439
3 SASI_Rn02_00224918 predicted 1452
4 SASI_Rn02_00224919 predicted 1273
5 SASI_Rn02_00224920 predicted 1522
6 SASI_Rn02_00224921 predicted 1482
7 SASI_Rn02_00224922 predicted 595
8 SASI_Rn02_00224923 predicted 575
9 SASI_Rn02_00224924 predicted 1260
10 SASI_Rn02_00224925 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293152 predicted 1922
2 SASI_Mm02_00293153 predicted 607
3 SASI_Mm02_00293154 predicted 621
4 SASI_Mm02_00293155 predicted 751
5 SASI_Mm02_00293156 predicted 605
6 SASI_Mm02_00293157 predicted 1926
7 SASI_Mm02_00293158 predicted 708
8 SASI_Mm02_00293159 predicted 2086
9 SASI_Mm02_00293160 predicted 1437
10 SASI_Mm02_00293161 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318635 predicted 1849
2 SASI_Mm01_00120615 predicted 535
3 SASI_Mm01_00120616 predicted 544
4 SASI_Mm01_00120617 predicted 676
5 SASI_Mm01_00120618 predicted 531
6 SASI_Mm02_00318636 predicted 1848
7 SASI_Mm01_00120619 predicted 625
8 SASI_Mm02_00318637 predicted 2007
9 SASI_Mm01_00120620 predicted 1363
10 SASI_Mm01_00120621 predicted 1289
11 SASI_Mm01_00120622 predicted 1305
12 SASI_Mm01_00120623 predicted 1519
13 SASI_Mm01_00120624 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002146
HOXB3 MISSION shRNA Bacterial Glycerol Stock
homeobox B3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2542s21c1
Sequence:CCGGCTTACATCTTTGTAGGTAATTCTCGAGAATTACCTACAAAGATGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002146.4-1228s21c1
Sequence:CCGGACCCTCACCAAACAGATATTCCTCGAGGAATATCTGTTTGGTGAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2644s21c1
Sequence:CCGGACACGTTCCCTTCCAACTTTCCTCGAGGAAAGTTGGAAGGGAACGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002146.3-2366s1c1
Sequence:CCGGCGGAAAGGAATCCACATCATACTCGAGTATGATGTGGATTCCTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-1154s1c1
Sequence:CCGGGCCACTAGCAACAGCAGTAATCTCGAGATTACTGCTGTTGCTAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-893s1c1
Sequence:CCGGGCTGCTCTCTTCGGAGGCTATCTCGAGATAGCCTCCGAAGAGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-2121s1c1
Sequence:CCGGGAATCCAAGAAGCGCCCAAATCTCGAGATTTGGGCGCTTCTTGGATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-1676s1c1
Sequence:CCGGGCCGGCTTCATGAACGCCTTACTCGAGTAAGGCGTTCATGAAGCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2158s21c1
Sequence:CCGGGAAAGGGCGAACGAGGATTAGCTCGAGCTAATCCTCGTTCGCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2520s21c1
Sequence:CCGGCATCACCAACCAACGGACTTACTCGAGTAAGTCCGTTGGTTGGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002146
HOXB3 MISSION shRNA shRNA Plasmid DNA
homeobox B3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2542s21c1
Sequence:CCGGCTTACATCTTTGTAGGTAATTCTCGAGAATTACCTACAAAGATGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002146.4-1228s21c1
Sequence:CCGGACCCTCACCAAACAGATATTCCTCGAGGAATATCTGTTTGGTGAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2644s21c1
Sequence:CCGGACACGTTCCCTTCCAACTTTCCTCGAGGAAAGTTGGAAGGGAACGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002146.3-2366s1c1
Sequence:CCGGCGGAAAGGAATCCACATCATACTCGAGTATGATGTGGATTCCTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-1154s1c1
Sequence:CCGGGCCACTAGCAACAGCAGTAATCTCGAGATTACTGCTGTTGCTAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-893s1c1
Sequence:CCGGGCTGCTCTCTTCGGAGGCTATCTCGAGATAGCCTCCGAAGAGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-2121s1c1
Sequence:CCGGGAATCCAAGAAGCGCCCAAATCTCGAGATTTGGGCGCTTCTTGGATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-1676s1c1
Sequence:CCGGGCCGGCTTCATGAACGCCTTACTCGAGTAAGGCGTTCATGAAGCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2158s21c1
Sequence:CCGGGAAAGGGCGAACGAGGATTAGCTCGAGCTAATCCTCGTTCGCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2520s21c1
Sequence:CCGGCATCACCAACCAACGGACTTACTCGAGTAAGTCCGTTGGTTGGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002146
HOXB3 MISSION shRNA Lentiviral Transduction Particles
homeobox B3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2542s21c1
Sequence:CCGGCTTACATCTTTGTAGGTAATTCTCGAGAATTACCTACAAAGATGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002146.4-1228s21c1
Sequence:CCGGACCCTCACCAAACAGATATTCCTCGAGGAATATCTGTTTGGTGAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2644s21c1
Sequence:CCGGACACGTTCCCTTCCAACTTTCCTCGAGGAAAGTTGGAAGGGAACGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002146.3-2366s1c1
Sequence:CCGGCGGAAAGGAATCCACATCATACTCGAGTATGATGTGGATTCCTTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-1154s1c1
Sequence:CCGGGCCACTAGCAACAGCAGTAATCTCGAGATTACTGCTGTTGCTAGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-893s1c1
Sequence:CCGGGCTGCTCTCTTCGGAGGCTATCTCGAGATAGCCTCCGAAGAGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-2121s1c1
Sequence:CCGGGAATCCAAGAAGCGCCCAAATCTCGAGATTTGGGCGCTTCTTGGATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002146.3-1676s1c1
Sequence:CCGGGCCGGCTTCATGAACGCCTTACTCGAGTAAGGCGTTCATGAAGCCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2158s21c1
Sequence:CCGGGAAAGGGCGAACGAGGATTAGCTCGAGCTAATCCTCGTTCGCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002146.4-2520s21c1
Sequence:CCGGCATCACCAACCAACGGACTTACTCGAGTAAGTCCGTTGGTTGGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010458
HOXB3 MISSION shRNA Bacterial Glycerol Stock
homeobox B3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010458.2-2189s21c1
Sequence:CCGGATCAGCAAGCAATCAACTTACCTCGAGGTAAGTTGATTGCTTGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-765s1c1
Sequence:CCGGACCTACCAGTACCACTAGCAACTCGAGTTGCTAGTGGTACTGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-1204s1c1
Sequence:CCGGCGTCGCATGAAGTACAAGAAACTCGAGTTTCTTGTACTTCATGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-849s1c1
Sequence:CCGGCACCCTCACCAAACAGATATTCTCGAGAATATCTGTTTGGTGAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-546s1c1
Sequence:CCGGTGGCAGCAATGGTTTCGGCTACTCGAGTAGCCGAAACCATTGCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-1670s1c1
Sequence:CCGGCCAACCAGCATCATGGACCCTCTCGAGAGGGTCCATGATGCTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010458.2-2158s21c1
Sequence:CCGGAGAAGCACATTCAACACTTAACTCGAGTTAAGTGTTGAATGTGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010458
HOXB3 MISSION shRNA shRNA Plasmid DNA
homeobox B3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010458.2-2189s21c1
Sequence:CCGGATCAGCAAGCAATCAACTTACCTCGAGGTAAGTTGATTGCTTGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-765s1c1
Sequence:CCGGACCTACCAGTACCACTAGCAACTCGAGTTGCTAGTGGTACTGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-1204s1c1
Sequence:CCGGCGTCGCATGAAGTACAAGAAACTCGAGTTTCTTGTACTTCATGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-849s1c1
Sequence:CCGGCACCCTCACCAAACAGATATTCTCGAGAATATCTGTTTGGTGAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-546s1c1
Sequence:CCGGTGGCAGCAATGGTTTCGGCTACTCGAGTAGCCGAAACCATTGCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-1670s1c1
Sequence:CCGGCCAACCAGCATCATGGACCCTCTCGAGAGGGTCCATGATGCTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010458.2-2158s21c1
Sequence:CCGGAGAAGCACATTCAACACTTAACTCGAGTTAAGTGTTGAATGTGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010458
HOXB3 MISSION shRNA Lentiviral Transduction Particles
homeobox B3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010458.2-2189s21c1
Sequence:CCGGATCAGCAAGCAATCAACTTACCTCGAGGTAAGTTGATTGCTTGCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-765s1c1
Sequence:CCGGACCTACCAGTACCACTAGCAACTCGAGTTGCTAGTGGTACTGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-1204s1c1
Sequence:CCGGCGTCGCATGAAGTACAAGAAACTCGAGTTTCTTGTACTTCATGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-849s1c1
Sequence:CCGGCACCCTCACCAAACAGATATTCTCGAGAATATCTGTTTGGTGAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-546s1c1
Sequence:CCGGTGGCAGCAATGGTTTCGGCTACTCGAGTAGCCGAAACCATTGCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010458.1-1670s1c1
Sequence:CCGGCCAACCAGCATCATGGACCCTCTCGAGAGGGTCCATGATGCTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010458.2-2158s21c1
Sequence:CCGGAGAAGCACATTCAACACTTAACTCGAGTTAAGTGTTGAATGTGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)