EMAIL THIS PAGE TO A FRIEND

HOXB4

homeobox B4

103 Gene Product Result for
Synonyms: HOX-2.6 HOX2 HOX2F
UniProtKB ID: P17483, Q9NTA0
Gene ID:
Human(3214) Summary: This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Intracellular or ectopic expression of this protein expands hematopoietic stem and progenitor cells in vivo and in vitro, making it a potential candidate for therapeutic stem cell expansion. [provided by RefSeq, Jul 2008]
Mouse(15412) homeobox B4
Rat(497988) homeo box B4
sheep(101120851) homeobox B4
chicken(396230) homeobox B4
dog(608915) homeobox B4
cow(768240) homeobox B4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024015 Rosetta Predictions human pricing
NM_001100787 Rosetta Predictions rat pricing
NM_010459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102375 predicted 1165
2 SASI_Hs01_00102376 predicted 124
3 SASI_Hs01_00102377 predicted 1170
4 SASI_Hs01_00102378 predicted 138
5 SASI_Hs01_00102379 predicted 1679
6 SASI_Hs01_00102380 predicted 1948
7 SASI_Hs01_00102381 predicted 1435
8 SASI_Hs01_00102382 predicted 1959
9 SASI_Hs01_00102383 predicted 1425
10 SASI_Hs01_00102384 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210558 predicted 692
2 SASI_Rn02_00210559 predicted 699
3 SASI_Rn02_00210560 predicted 708
4 SASI_Rn02_00210561 predicted 686
5 SASI_Rn02_00210562 predicted 1333
6 SASI_Rn02_00210563 predicted 1120
7 SASI_Rn02_00210564 predicted 1112
8 SASI_Rn02_00210565 predicted 1339
9 SASI_Rn02_00210566 predicted 1406
10 SASI_Rn02_00210567 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137452 predicted 557
2 SASI_Mm01_00137453 predicted 980
3 SASI_Mm02_00318638 predicted 1176
4 SASI_Mm02_00318639 predicted 1254
5 SASI_Mm01_00137454 predicted 942
6 SASI_Mm02_00318640 predicted 1179
7 SASI_Mm01_00137458 predicted 85
8 SASI_Mm02_00318641 predicted 958
9 SASI_Mm02_00318642 predicted 105
10 SASI_Mm02_00318643 predicted 887
11 SASI_Mm01_00137449 predicted 995
12 SASI_Mm01_00137450 predicted 1006
13 SASI_Mm01_00137451 predicted 992
14 SASI_Mm01_00137455 predicted 1449
15 SASI_Mm01_00137456 predicted 1465
16 SASI_Mm01_00137457 predicted 1419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024015
HOXB4 MISSION shRNA Bacterial Glycerol Stock
homeobox B4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024015.4-1259s21c1
Sequence:CCGGCCTCGACACCCGCTAACAAATCTCGAGATTTGTTAGCGGGTGTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024015.4-1165s21c1
Sequence:CCGGTGGATCCACGTTTCATCTTTACTCGAGTAAAGATGAAACGTGGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-124s1c1
Sequence:CCGGAGGAATATTCACAGAGCGATTCTCGAGAATCGCTCTGTGAATATTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-140s1c1
Sequence:CCGGCGATTACCTACCCAGCGACCACTCGAGTGGTCGCTGGGTAGGTAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024015.3-940s1c1
Sequence:CCGGCCCACACTTTATATACGAATACTCGAGTATTCGTATATAAAGTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-453s1c1
Sequence:CCGGCCGTCCCACTCCGCGTGCAAACTCGAGTTTGCACGCGGAGTGGGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-503s1c1
Sequence:CCGGAGTTCACGTGAGCACGGTAAACTCGAGTTTACCGTGCTCACGTGAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024015
HOXB4 MISSION shRNA shRNA Plasmid DNA
homeobox B4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024015.4-1259s21c1
Sequence:CCGGCCTCGACACCCGCTAACAAATCTCGAGATTTGTTAGCGGGTGTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024015.4-1165s21c1
Sequence:CCGGTGGATCCACGTTTCATCTTTACTCGAGTAAAGATGAAACGTGGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-124s1c1
Sequence:CCGGAGGAATATTCACAGAGCGATTCTCGAGAATCGCTCTGTGAATATTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-140s1c1
Sequence:CCGGCGATTACCTACCCAGCGACCACTCGAGTGGTCGCTGGGTAGGTAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024015.3-940s1c1
Sequence:CCGGCCCACACTTTATATACGAATACTCGAGTATTCGTATATAAAGTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-453s1c1
Sequence:CCGGCCGTCCCACTCCGCGTGCAAACTCGAGTTTGCACGCGGAGTGGGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-503s1c1
Sequence:CCGGAGTTCACGTGAGCACGGTAAACTCGAGTTTACCGTGCTCACGTGAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024015
HOXB4 MISSION shRNA Lentiviral Transduction Particles
homeobox B4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024015.4-1259s21c1
Sequence:CCGGCCTCGACACCCGCTAACAAATCTCGAGATTTGTTAGCGGGTGTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024015.4-1165s21c1
Sequence:CCGGTGGATCCACGTTTCATCTTTACTCGAGTAAAGATGAAACGTGGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-124s1c1
Sequence:CCGGAGGAATATTCACAGAGCGATTCTCGAGAATCGCTCTGTGAATATTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-140s1c1
Sequence:CCGGCGATTACCTACCCAGCGACCACTCGAGTGGTCGCTGGGTAGGTAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024015.3-940s1c1
Sequence:CCGGCCCACACTTTATATACGAATACTCGAGTATTCGTATATAAAGTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-453s1c1
Sequence:CCGGCCGTCCCACTCCGCGTGCAAACTCGAGTTTGCACGCGGAGTGGGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024015.3-503s1c1
Sequence:CCGGAGTTCACGTGAGCACGGTAAACTCGAGTTTACCGTGCTCACGTGAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010459
HOXB4 MISSION shRNA Bacterial Glycerol Stock
homeobox B4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-939s21c1
Sequence:CCGGGGGTAGGGAAGCCTTATTTATCTCGAGATAAATAAGGCTTCCCTACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-1284s21c1
Sequence:CCGGCCTCGACACTTGGCTAACAAACTCGAGTTTGTTAGCCAAGTGTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010459.6-470s21c1
Sequence:CCGGGTTCACGTGAGCACGGTAAACCTCGAGGTTTACCGTGCTCACGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-1182s21c1
Sequence:CCGGTGGATCCAGGCTTCATCTTTACTCGAGTAAAGATGAAGCCTGGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010459.3-1374s1c1
Sequence:CCGGCCTCACTTTATCTATAAGGAACTCGAGTTCCTTATAGATAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-565s1c1
Sequence:CCGGAGGAGTATTCACAGAGCGATTCTCGAGAATCGCTCTGTGAATACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-1032s1c1
Sequence:CCGGGAGAAGGAGTTTCACTACAATCTCGAGATTGTAGTGAAACTCCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-569s1c1
Sequence:CCGGGTATTCACAGAGCGATTACCTCTCGAGAGGTAATCGCTCTGTGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-890s1c1
Sequence:CCGGCCCGTCCCACTCCGCGTTCAACTCGAGTTGAACGCGGAGTGGGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010459
HOXB4 MISSION shRNA shRNA Plasmid DNA
homeobox B4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-939s21c1
Sequence:CCGGGGGTAGGGAAGCCTTATTTATCTCGAGATAAATAAGGCTTCCCTACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-1284s21c1
Sequence:CCGGCCTCGACACTTGGCTAACAAACTCGAGTTTGTTAGCCAAGTGTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010459.6-470s21c1
Sequence:CCGGGTTCACGTGAGCACGGTAAACCTCGAGGTTTACCGTGCTCACGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-1182s21c1
Sequence:CCGGTGGATCCAGGCTTCATCTTTACTCGAGTAAAGATGAAGCCTGGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010459.3-1374s1c1
Sequence:CCGGCCTCACTTTATCTATAAGGAACTCGAGTTCCTTATAGATAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-565s1c1
Sequence:CCGGAGGAGTATTCACAGAGCGATTCTCGAGAATCGCTCTGTGAATACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-1032s1c1
Sequence:CCGGGAGAAGGAGTTTCACTACAATCTCGAGATTGTAGTGAAACTCCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-569s1c1
Sequence:CCGGGTATTCACAGAGCGATTACCTCTCGAGAGGTAATCGCTCTGTGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-890s1c1
Sequence:CCGGCCCGTCCCACTCCGCGTTCAACTCGAGTTGAACGCGGAGTGGGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010459
HOXB4 MISSION shRNA Lentiviral Transduction Particles
homeobox B4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-939s21c1
Sequence:CCGGGGGTAGGGAAGCCTTATTTATCTCGAGATAAATAAGGCTTCCCTACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-1284s21c1
Sequence:CCGGCCTCGACACTTGGCTAACAAACTCGAGTTTGTTAGCCAAGTGTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010459.6-470s21c1
Sequence:CCGGGTTCACGTGAGCACGGTAAACCTCGAGGTTTACCGTGCTCACGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010459.6-1182s21c1
Sequence:CCGGTGGATCCAGGCTTCATCTTTACTCGAGTAAAGATGAAGCCTGGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010459.3-1374s1c1
Sequence:CCGGCCTCACTTTATCTATAAGGAACTCGAGTTCCTTATAGATAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-565s1c1
Sequence:CCGGAGGAGTATTCACAGAGCGATTCTCGAGAATCGCTCTGTGAATACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-1032s1c1
Sequence:CCGGGAGAAGGAGTTTCACTACAATCTCGAGATTGTAGTGAAACTCCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-569s1c1
Sequence:CCGGGTATTCACAGAGCGATTACCTCTCGAGAGGTAATCGCTCTGTGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010459.3-890s1c1
Sequence:CCGGCCCGTCCCACTCCGCGTTCAACTCGAGTTGAACGCGGAGTGGGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)