EMAIL THIS PAGE TO A FRIEND

HOXB5

homeobox B5

121 Gene Product Result for
Synonyms: HHO.C10 HOX2 HOX2A HU-1 Hox2.1
UniProtKB ID: P09067, B2RC69, P09069, Q17RP4
Gene ID:
Human(3215) Summary: This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in lung and gut development. Increased expression of this gene is associated with a distinct biologic subset of acute myeloid leukemia (AML) and the occurrence of bronchopulmonary sequestration (BPS) and congenital cystic adenomatoid malformation (CCAM) tissue. [provided by RefSeq, Jul 2008]
Mouse(15413) homeobox B5
Rat(497987) homeo box B5
chicken(425096) homeobox B5
dog(100686000) homeobox B5
sheep(101115382) homeobox B5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024191 MISSION® esiRNA esiRNA human HOXB5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002147 Rosetta Predictions human pricing
XM_001081293 Rosetta Predictions rat pricing
XM_573183 Rosetta Predictions rat pricing
NM_008268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141458 predicted 441
2 SASI_Hs01_00141459 predicted 434
3 SASI_Hs01_00141460 predicted 434
4 SASI_Hs01_00141461 predicted 587
5 SASI_Hs01_00141462 predicted 604
6 SASI_Hs01_00141464 predicted 804
7 SASI_Hs01_00141465 predicted 796
8 SASI_Hs01_00141463 predicted 596
9 SASI_Hs01_00141466 predicted 109
10 SASI_Hs02_00333332 predicted 1108
11 SASI_Hs01_00141467 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371348 predicted 234
2 SASI_Rn02_00371349 predicted 388
3 SASI_Rn02_00371350 predicted 478
4 SASI_Rn02_00371351 predicted 473
5 SASI_Rn02_00371352 predicted 220
6 SASI_Rn02_00371353 predicted 643
7 SASI_Rn02_00371354 predicted 530
8 SASI_Rn02_00371355 predicted 628
9 SASI_Rn02_00371356 predicted 641
10 SASI_Rn02_00371357 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399964 predicted 842
2 SASI_Rn02_00399965 predicted 841
3 SASI_Rn02_00399966 predicted 841
4 SASI_Rn02_00399967 predicted 1287
5 SASI_Rn02_00399968 predicted 150
6 SASI_Rn02_00399969 predicted 1295
7 SASI_Rn02_00399970 predicted 234
8 SASI_Rn02_00399971 predicted 1286
9 SASI_Rn02_00399972 predicted 478
10 SASI_Rn02_00399973 predicted 179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120996 predicted 233
2 SASI_Mm02_00313495 predicted 474
3 SASI_Mm01_00120998 predicted 220
4 SASI_Mm01_00121000 predicted 630
5 SASI_Mm02_00313496 predicted 645
6 SASI_Mm01_00121001 predicted 252
7 SASI_Mm01_00120997 predicted 481
8 SASI_Mm01_00120999 predicted 643
9 SASI_Mm01_00121002 predicted 892
10 SASI_Mm01_00121003 predicted 634
11 SASI_Mm01_00121004 predicted 1297
12 SASI_Mm01_00121005 predicted 154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002147
HOXB5 MISSION shRNA Bacterial Glycerol Stock
homeobox B5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-209s1c1
Sequence:CCGGCGGCTACAATTACAATGGGATCTCGAGATCCCATTGTAATTGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002147.2-1146s1c1
Sequence:CCGGCGCCAGTGTTTCTGAATGTTTCTCGAGAAACATTCAGAAACACTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-452s1c1
Sequence:CCGGCAGCGCCAATTTCACCGAAATCTCGAGATTTCGGTGAAATTGGCGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-123s1c1
Sequence:CCGGCCGGACTATCAGTTGCTAAATCTCGAGATTTAGCAACTGATAGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-620s1c1
Sequence:CCGGGCTTCACATCAGCCATGATATCTCGAGATATCATGGCTGATGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002147.3-806s21c1
Sequence:CCGGGAAGAAGGACAACAAATTGAACTCGAGTTCAATTTGTTGTCCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002147.3-141s21c1
Sequence:CCGGAGCTCTCTGAGCGGCTCTTACCTCGAGGTAAGAGCCGCTCAGAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002147.3-983s21c1
Sequence:CCGGTCGCCTTGTGTTACGATATTTCTCGAGAAATATCGTAACACAAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002147
HOXB5 MISSION shRNA shRNA Plasmid DNA
homeobox B5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-209s1c1
Sequence:CCGGCGGCTACAATTACAATGGGATCTCGAGATCCCATTGTAATTGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002147.2-1146s1c1
Sequence:CCGGCGCCAGTGTTTCTGAATGTTTCTCGAGAAACATTCAGAAACACTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-452s1c1
Sequence:CCGGCAGCGCCAATTTCACCGAAATCTCGAGATTTCGGTGAAATTGGCGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-123s1c1
Sequence:CCGGCCGGACTATCAGTTGCTAAATCTCGAGATTTAGCAACTGATAGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-620s1c1
Sequence:CCGGGCTTCACATCAGCCATGATATCTCGAGATATCATGGCTGATGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002147.3-806s21c1
Sequence:CCGGGAAGAAGGACAACAAATTGAACTCGAGTTCAATTTGTTGTCCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002147.3-141s21c1
Sequence:CCGGAGCTCTCTGAGCGGCTCTTACCTCGAGGTAAGAGCCGCTCAGAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002147.3-983s21c1
Sequence:CCGGTCGCCTTGTGTTACGATATTTCTCGAGAAATATCGTAACACAAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002147
HOXB5 MISSION shRNA Lentiviral Transduction Particles
homeobox B5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-209s1c1
Sequence:CCGGCGGCTACAATTACAATGGGATCTCGAGATCCCATTGTAATTGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002147.2-1146s1c1
Sequence:CCGGCGCCAGTGTTTCTGAATGTTTCTCGAGAAACATTCAGAAACACTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-452s1c1
Sequence:CCGGCAGCGCCAATTTCACCGAAATCTCGAGATTTCGGTGAAATTGGCGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-123s1c1
Sequence:CCGGCCGGACTATCAGTTGCTAAATCTCGAGATTTAGCAACTGATAGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002147.2-620s1c1
Sequence:CCGGGCTTCACATCAGCCATGATATCTCGAGATATCATGGCTGATGTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002147.3-806s21c1
Sequence:CCGGGAAGAAGGACAACAAATTGAACTCGAGTTCAATTTGTTGTCCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002147.3-141s21c1
Sequence:CCGGAGCTCTCTGAGCGGCTCTTACCTCGAGGTAAGAGCCGCTCAGAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002147.3-983s21c1
Sequence:CCGGTCGCCTTGTGTTACGATATTTCTCGAGAAATATCGTAACACAAGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008268
HOXB5 MISSION shRNA Bacterial Glycerol Stock
homeobox B5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-648s1c1
Sequence:CCGGGCTTCACATCAGCCACGATATCTCGAGATATCGTGGCTGATGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-849s1c1
Sequence:CCGGGAAGAAAGACAACAAACTGAACTCGAGTTCAGTTTGTTGTCTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-183s1c1
Sequence:CCGGCAGCTCTCTGAGCGGCTCTTACTCGAGTAAGAGCCGCTCAGAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-227s1c1
Sequence:CCGGCCGGCTCTTACGGCTACAATTCTCGAGAATTGTAGCCGTAAGAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-835s1c1
Sequence:CCGGCGTCGCATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008268.2-152s21c1
Sequence:CCGGCGGACTATCAGTTGCTAAATTCTCGAGAATTTAGCAACTGATAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008268.2-1093s21c1
Sequence:CCGGGACTGGTTATCTTGTTATTATCTCGAGATAATAACAAGATAACCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008268
HOXB5 MISSION shRNA shRNA Plasmid DNA
homeobox B5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-648s1c1
Sequence:CCGGGCTTCACATCAGCCACGATATCTCGAGATATCGTGGCTGATGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-849s1c1
Sequence:CCGGGAAGAAAGACAACAAACTGAACTCGAGTTCAGTTTGTTGTCTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-183s1c1
Sequence:CCGGCAGCTCTCTGAGCGGCTCTTACTCGAGTAAGAGCCGCTCAGAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-227s1c1
Sequence:CCGGCCGGCTCTTACGGCTACAATTCTCGAGAATTGTAGCCGTAAGAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-835s1c1
Sequence:CCGGCGTCGCATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008268.2-152s21c1
Sequence:CCGGCGGACTATCAGTTGCTAAATTCTCGAGAATTTAGCAACTGATAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008268.2-1093s21c1
Sequence:CCGGGACTGGTTATCTTGTTATTATCTCGAGATAATAACAAGATAACCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008268
HOXB5 MISSION shRNA Lentiviral Transduction Particles
homeobox B5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-648s1c1
Sequence:CCGGGCTTCACATCAGCCACGATATCTCGAGATATCGTGGCTGATGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-849s1c1
Sequence:CCGGGAAGAAAGACAACAAACTGAACTCGAGTTCAGTTTGTTGTCTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-183s1c1
Sequence:CCGGCAGCTCTCTGAGCGGCTCTTACTCGAGTAAGAGCCGCTCAGAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-227s1c1
Sequence:CCGGCCGGCTCTTACGGCTACAATTCTCGAGAATTGTAGCCGTAAGAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008268.1-835s1c1
Sequence:CCGGCGTCGCATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008268.2-152s21c1
Sequence:CCGGCGGACTATCAGTTGCTAAATTCTCGAGAATTTAGCAACTGATAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008268.2-1093s21c1
Sequence:CCGGGACTGGTTATCTTGTTATTATCTCGAGATAATAACAAGATAACCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)