EMAIL THIS PAGE TO A FRIEND

HOXB6

homeobox B6

81 Gene Product Result for
Synonyms: HOX2 HOX2B HU-2 Hox-2.2
UniProtKB ID: P17509, A8K835, D3DTV5, P09068, Q9HB11, Q9UGH2
Gene ID:
Human(3216) Summary: This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development, including that of lung and skin, and has been localized to both the nucleus and cytoplasm. Altered expression of this gene or a change in the subcellular localization of its protein is associated with some cases of acute myeloid leukemia and colorectal cancer. [provided by RefSeq, Jul 2008]
Mouse(15414) homeobox B6
Rat(497986) homeo box B6
chicken(777548) homeobox B6
cow(100337380) homeobox B6
dog(491056) homeobox B6
sheep(101120592) homeobox B6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018952 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU208191 MISSION® esiRNA esiRNA targeting mouse Hoxb6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018952 Rosetta Predictions human pricing
XM_001081290 Rosetta Predictions rat pricing
XM_573182 Rosetta Predictions rat pricing
NM_008269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234866 predicted 1250
2 SASI_Hs01_00234867 predicted 1264
3 SASI_Hs01_00234868 predicted 400
4 SASI_Hs02_00352424 predicted 654
5 SASI_Hs01_00234869 predicted 1278
6 SASI_Hs01_00234871 predicted 1309
7 SASI_Hs01_00234872 predicted 720
8 SASI_Hs01_00234873 predicted 1167
9 SASI_Hs01_00234874 predicted 729
10 SASI_Hs01_00234875 predicted 566
11 SASI_Hs01_00234870 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371338 predicted 792
2 SASI_Rn02_00371339 predicted 1609
3 SASI_Rn02_00371340 predicted 710
4 SASI_Rn02_00371341 predicted 751
5 SASI_Rn02_00371342 predicted 1403
6 SASI_Rn02_00371343 predicted 1604
7 SASI_Rn02_00371344 predicted 1024
8 SASI_Rn02_00371345 predicted 1033
9 SASI_Rn02_00371346 predicted 1462
10 SASI_Rn02_00371347 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399954 predicted 1656
2 SASI_Rn02_00399955 predicted 794
3 SASI_Rn02_00399956 predicted 1614
4 SASI_Rn02_00399957 predicted 710
5 SASI_Rn02_00399958 predicted 745
6 SASI_Rn02_00399959 predicted 1406
7 SASI_Rn02_00399960 predicted 1603
8 SASI_Rn02_00399961 predicted 1019
9 SASI_Rn02_00399962 predicted 1034
10 SASI_Rn02_00399963 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313497 predicted 992
2 SASI_Mm02_00313498 predicted 621
3 SASI_Mm02_00313499 predicted 977
4 SASI_Mm02_00313500 predicted 350
5 SASI_Mm02_00313501 predicted 937
6 SASI_Mm02_00313502 predicted 385
7 SASI_Mm02_00313503 predicted 397
8 SASI_Mm02_00313504 predicted 985
9 SASI_Mm02_00313505 predicted 375
10 SASI_Mm02_00313506 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008269
HOXB6 MISSION shRNA Bacterial Glycerol Stock
homeobox B6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-563s21c1
Sequence:CCGGCCGAGCGGCAGATCAAGATTTCTCGAGAAATCTTGATCTGCCGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-411s21c1
Sequence:CCGGTTCGTGCAACAGTTCCTCTTTCTCGAGAAAGAGGAACTGTTGCACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008269.1-1031s21c1
Sequence:CCGGGCACGGTTCAATGGTAGATTCCTCGAGGAATCTACCATTGAACCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-338s21c1
Sequence:CCGGACAAGAGCGTGTTCGGAGAGACTCGAGTCTCTCCGAACACGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-163s21c1
Sequence:CCGGTTTGCGGCGTCCTCCTATTACCTCGAGGTAATAGGAGGACGCCGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-568s1c1
Sequence:CCGGCGGCAGATCAAGATTTGGTTTCTCGAGAAACCAAATCTTGATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-237s1c1
Sequence:CCGGGCCTGCCTTCTACCGGGAGAACTCGAGTTCTCCCGGTAGAAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-404s1c1
Sequence:CCGGGCATGAATTCGTGCAACAGTTCTCGAGAACTGTTGCACGAATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-81s1c1
Sequence:CCGGGCCGCTCTACTCGTCTGGCTACTCGAGTAGCCAGACGAGTAGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-330s1c1
Sequence:CCGGCGCACAGGACAAGAGCGTGTTCTCGAGAACACGCTCTTGTCCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008269
HOXB6 MISSION shRNA shRNA Plasmid DNA
homeobox B6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-563s21c1
Sequence:CCGGCCGAGCGGCAGATCAAGATTTCTCGAGAAATCTTGATCTGCCGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-411s21c1
Sequence:CCGGTTCGTGCAACAGTTCCTCTTTCTCGAGAAAGAGGAACTGTTGCACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008269.1-1031s21c1
Sequence:CCGGGCACGGTTCAATGGTAGATTCCTCGAGGAATCTACCATTGAACCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-338s21c1
Sequence:CCGGACAAGAGCGTGTTCGGAGAGACTCGAGTCTCTCCGAACACGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-163s21c1
Sequence:CCGGTTTGCGGCGTCCTCCTATTACCTCGAGGTAATAGGAGGACGCCGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-568s1c1
Sequence:CCGGCGGCAGATCAAGATTTGGTTTCTCGAGAAACCAAATCTTGATCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-237s1c1
Sequence:CCGGGCCTGCCTTCTACCGGGAGAACTCGAGTTCTCCCGGTAGAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-404s1c1
Sequence:CCGGGCATGAATTCGTGCAACAGTTCTCGAGAACTGTTGCACGAATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-81s1c1
Sequence:CCGGGCCGCTCTACTCGTCTGGCTACTCGAGTAGCCAGACGAGTAGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-330s1c1
Sequence:CCGGCGCACAGGACAAGAGCGTGTTCTCGAGAACACGCTCTTGTCCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008269
HOXB6 MISSION shRNA Lentiviral Transduction Particles
homeobox B6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-563s21c1
Sequence:CCGGCCGAGCGGCAGATCAAGATTTCTCGAGAAATCTTGATCTGCCGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-411s21c1
Sequence:CCGGTTCGTGCAACAGTTCCTCTTTCTCGAGAAAGAGGAACTGTTGCACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008269.1-1031s21c1
Sequence:CCGGGCACGGTTCAATGGTAGATTCCTCGAGGAATCTACCATTGAACCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-338s21c1
Sequence:CCGGACAAGAGCGTGTTCGGAGAGACTCGAGTCTCTCCGAACACGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008269.1-163s21c1
Sequence:CCGGTTTGCGGCGTCCTCCTATTACCTCGAGGTAATAGGAGGACGCCGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-568s1c1
Sequence:CCGGCGGCAGATCAAGATTTGGTTTCTCGAGAAACCAAATCTTGATCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-237s1c1
Sequence:CCGGGCCTGCCTTCTACCGGGAGAACTCGAGTTCTCCCGGTAGAAGGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-404s1c1
Sequence:CCGGGCATGAATTCGTGCAACAGTTCTCGAGAACTGTTGCACGAATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-81s1c1
Sequence:CCGGGCCGCTCTACTCGTCTGGCTACTCGAGTAGCCAGACGAGTAGAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008269.1-330s1c1
Sequence:CCGGCGCACAGGACAAGAGCGTGTTCTCGAGAACACGCTCTTGTCCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018952
VALIDATED
HOXB6 MISSION shRNA Bacterial Glycerol Stock
homeobox B6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-1279s21c1
Sequence:CCGGAGCGGACTCACTTGATGTTTCCTCGAGGAAACATCAAGTGAGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-882s21c1
Sequence:CCGGCGGAGAGGCAGATCAAGATATCTCGAGATATCTTGATCTGCCTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018952.4-421s21c1
Sequence:CCGGTGCGGACCCGCTGAGACATTACTCGAGTAATGTCTCAGCGGGTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-732s21c1
Sequence:CCGGCGTGCAACAGTTCCTCCTTTGCTCGAGCAAAGGAGGAACTGTTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-482s21c1
Sequence:CCGGTTTGCCACTTCCTCCTATTACCTCGAGGTAATAGGAGGAAGTGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018952.3-1466s1c1
Sequence:CCGGGCACATACTACCTAGAAGTAACTCGAGTTACTTCTAGGTAGTATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-557s1c1
Sequence:CCGGCCGGCCTTCTACCGCGAGAAACTCGAGTTTCTCGCGGTAGAAGGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-401s1c1
Sequence:CCGGCCGCTCTATTCGTCGGGCTATCTCGAGATAGCCCGACGAATAGAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-480s1c1
Sequence:CCGGGCTTTGCCACTTCCTCCTATTCTCGAGAATAGGAGGAAGTGGCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-772s1c1
Sequence:CCGGCCGCCAGACATACACACGTTACTCGAGTAACGTGTGTATGTCTGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018952
VALIDATED
HOXB6 MISSION shRNA shRNA Plasmid DNA
homeobox B6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-1279s21c1
Sequence:CCGGAGCGGACTCACTTGATGTTTCCTCGAGGAAACATCAAGTGAGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-882s21c1
Sequence:CCGGCGGAGAGGCAGATCAAGATATCTCGAGATATCTTGATCTGCCTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018952.4-421s21c1
Sequence:CCGGTGCGGACCCGCTGAGACATTACTCGAGTAATGTCTCAGCGGGTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-732s21c1
Sequence:CCGGCGTGCAACAGTTCCTCCTTTGCTCGAGCAAAGGAGGAACTGTTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-482s21c1
Sequence:CCGGTTTGCCACTTCCTCCTATTACCTCGAGGTAATAGGAGGAAGTGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018952.3-1466s1c1
Sequence:CCGGGCACATACTACCTAGAAGTAACTCGAGTTACTTCTAGGTAGTATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-557s1c1
Sequence:CCGGCCGGCCTTCTACCGCGAGAAACTCGAGTTTCTCGCGGTAGAAGGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-401s1c1
Sequence:CCGGCCGCTCTATTCGTCGGGCTATCTCGAGATAGCCCGACGAATAGAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-480s1c1
Sequence:CCGGGCTTTGCCACTTCCTCCTATTCTCGAGAATAGGAGGAAGTGGCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-772s1c1
Sequence:CCGGCCGCCAGACATACACACGTTACTCGAGTAACGTGTGTATGTCTGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018952
VALIDATED
HOXB6 MISSION shRNA Lentiviral Transduction Particles
homeobox B6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-1279s21c1
Sequence:CCGGAGCGGACTCACTTGATGTTTCCTCGAGGAAACATCAAGTGAGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-882s21c1
Sequence:CCGGCGGAGAGGCAGATCAAGATATCTCGAGATATCTTGATCTGCCTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018952.4-421s21c1
Sequence:CCGGTGCGGACCCGCTGAGACATTACTCGAGTAATGTCTCAGCGGGTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-732s21c1
Sequence:CCGGCGTGCAACAGTTCCTCCTTTGCTCGAGCAAAGGAGGAACTGTTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018952.4-482s21c1
Sequence:CCGGTTTGCCACTTCCTCCTATTACCTCGAGGTAATAGGAGGAAGTGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018952.3-1466s1c1
Sequence:CCGGGCACATACTACCTAGAAGTAACTCGAGTTACTTCTAGGTAGTATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-557s1c1
Sequence:CCGGCCGGCCTTCTACCGCGAGAAACTCGAGTTTCTCGCGGTAGAAGGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-401s1c1
Sequence:CCGGCCGCTCTATTCGTCGGGCTATCTCGAGATAGCCCGACGAATAGAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-480s1c1
Sequence:CCGGGCTTTGCCACTTCCTCCTATTCTCGAGAATAGGAGGAAGTGGCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018952.3-772s1c1
Sequence:CCGGCCGCCAGACATACACACGTTACTCGAGTAACGTGTGTATGTCTGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)