EMAIL THIS PAGE TO A FRIEND

HOXB7

homeobox B7

89 Gene Product Result for
Synonyms: HHO.C1 HOX2 HOX2C Hox-2.3
UniProtKB ID: P09629, A8K3N8, Q15957, Q53FN3, Q96BQ6
Gene ID:
Human(3217) Summary: This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded nuclear protein functions as a sequence-specific transcription factor that is involved in cell proliferation and differentiation. Increased expression of this gene is associated with some cases of melanoma and ovarian carcinoma. [provided by RefSeq, Jul 2008]
Mouse(15415) homeobox B7
Rat(497985) homeo box B7
chicken(425962) homeobox B7
dog(608962) homeobox B7
cow(281820) homeobox B7
sheep(101115137) homeobox B7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37068 Anti-HOXB7 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, canine, bovine, mouse, rat, rabbit, human
western blot pricing
AV34393 Anti-HOXB7 (AB2) antibody produced in rabbit IgG fraction of antiserum rat, bovine, mouse, horse, human
western blot pricing
H0541 Anti-HOXB7 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1412036 ANTI-HOXB7 antibody produced in mouse clone 4A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412037 ANTI-HOXB7 antibody produced in mouse clone 3F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412447 ANTI-HOXB7 antibody produced in mouse clone 4C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2107960 Anti-HOXB7 antibody produced in rabbit affinity isolated antibody horse, zebrafish, canine, mouse, rabbit, rat, guinea pig, bovine, human, pig
western blot pricing
AV38482 Anti-HOXB7 antibody produced in rabbit affinity isolated antibody, lyophilized powder , chicken, rat, canine, mouse, human, zebrafish
western blot pricing
H0291 Anti-HOXB7 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution immunofluorescence, immunoprecipitation (IP), western blot pricing
HPA049940 Anti-HOXB7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106407 Anti-HOXB7 antibody produced in rabbit affinity isolated antibody mouse, horse, rabbit
ELISA, western blot pricing
WH0003217M1 Monoclonal Anti-HOXB7 antibody produced in mouse clone 4F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403935 Monoclonal Anti-HOXB7 antibody produced in mouse clone 5B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052071 MISSION® esiRNA esiRNA human HOXB7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004502 Rosetta Predictions human pricing
NM_001017480 Rosetta Predictions rat pricing
NM_010460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110769 predicted 492
2 SASI_Hs01_00110770 predicted 1123
3 SASI_Hs01_00110771 predicted 1119
4 SASI_Hs01_00110772 predicted 492
5 SASI_Hs01_00110774 predicted 340
6 SASI_Hs01_00110775 predicted 443
7 SASI_Hs01_00110776 predicted 354
8 SASI_Hs01_00110777 predicted 1080
9 SASI_Hs01_00110778 predicted 309
10 SASI_Hs02_00337760 predicted 457
11 SASI_Hs01_00110773 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202290 predicted 258
2 SASI_Rn01_00056009 predicted 365
3 SASI_Rn01_00056010 predicted 373
4 SASI_Rn01_00056012 predicted 278
5 SASI_Rn01_00056013 predicted 258
6 SASI_Rn02_00202291 predicted 250
7 SASI_Rn01_00056014 predicted 240
8 SASI_Rn01_00056015 predicted 374
9 SASI_Rn01_00056016 predicted 219
10 SASI_Rn01_00056017 predicted 244
11 SASI_Rn01_00056011 predicted 276
12 SASI_Rn01_00056018 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033108 predicted 317
2 SASI_Mm01_00033109 predicted 429
3 SASI_Mm01_00033110 predicted 234
4 SASI_Mm01_00033111 predicted 330
5 SASI_Mm01_00033112 predicted 340
6 SASI_Mm01_00033113 predicted 317
7 SASI_Mm01_00033114 predicted 310
8 SASI_Mm01_00033115 predicted 347
9 SASI_Mm01_00033116 predicted 215
10 SASI_Mm01_00033117 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004502
VALIDATED
HOXB7 MISSION shRNA Bacterial Glycerol Stock
homeobox B7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004502.2-1120s1c1
Sequence:CCGGGCCCTCTTTAATGCTGTCTTTCTCGAGAAAGACAGCATTAAAGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-624s1c1
Sequence:CCGGCCTCACGGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCCGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-180s1c1
Sequence:CCGGAGAACAAACTTCTTGTGCGTTCTCGAGAACGCACAAGAAGTTTGTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-339s1c1
Sequence:CCGGCGAGCCGAGTTCCTTCAACATCTCGAGATGTTGAAGGAACTCGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-459s1c1
Sequence:CCGGCGAGAGTAACTTCCGGATCTACTCGAGTAGATCCGGAAGTTACTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004502.3-1124s21c1
Sequence:CCGGGCCCTCTTTAATGCTGTCTTTCTCGAGAAAGACAGCATTAAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-749s21c1
Sequence:CCGGGAAGAGTGAGGGATGGAGAAACTCGAGTTTCTCCATCCCTCACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-491s21c1
Sequence:CCGGATGCGAAGCTCAGGAACTGACCTCGAGGTCAGTTCCTGAGCTTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-144s21c1
Sequence:CCGGATCCAGCCTCAAGTTCGGTTTCTCGAGAAACCGAACTTGAGGCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-628s21c1
Sequence:CCGGCCTCACGGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCCGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004502
VALIDATED
HOXB7 MISSION shRNA shRNA Plasmid DNA
homeobox B7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004502.2-1120s1c1
Sequence:CCGGGCCCTCTTTAATGCTGTCTTTCTCGAGAAAGACAGCATTAAAGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-624s1c1
Sequence:CCGGCCTCACGGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCCGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-180s1c1
Sequence:CCGGAGAACAAACTTCTTGTGCGTTCTCGAGAACGCACAAGAAGTTTGTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-339s1c1
Sequence:CCGGCGAGCCGAGTTCCTTCAACATCTCGAGATGTTGAAGGAACTCGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-459s1c1
Sequence:CCGGCGAGAGTAACTTCCGGATCTACTCGAGTAGATCCGGAAGTTACTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004502.3-1124s21c1
Sequence:CCGGGCCCTCTTTAATGCTGTCTTTCTCGAGAAAGACAGCATTAAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-749s21c1
Sequence:CCGGGAAGAGTGAGGGATGGAGAAACTCGAGTTTCTCCATCCCTCACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-491s21c1
Sequence:CCGGATGCGAAGCTCAGGAACTGACCTCGAGGTCAGTTCCTGAGCTTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-144s21c1
Sequence:CCGGATCCAGCCTCAAGTTCGGTTTCTCGAGAAACCGAACTTGAGGCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-628s21c1
Sequence:CCGGCCTCACGGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCCGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004502
VALIDATED
HOXB7 MISSION shRNA Lentiviral Transduction Particles
homeobox B7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004502.2-1120s1c1
Sequence:CCGGGCCCTCTTTAATGCTGTCTTTCTCGAGAAAGACAGCATTAAAGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-624s1c1
Sequence:CCGGCCTCACGGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCCGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-180s1c1
Sequence:CCGGAGAACAAACTTCTTGTGCGTTCTCGAGAACGCACAAGAAGTTTGTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-339s1c1
Sequence:CCGGCGAGCCGAGTTCCTTCAACATCTCGAGATGTTGAAGGAACTCGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004502.2-459s1c1
Sequence:CCGGCGAGAGTAACTTCCGGATCTACTCGAGTAGATCCGGAAGTTACTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004502.3-1124s21c1
Sequence:CCGGGCCCTCTTTAATGCTGTCTTTCTCGAGAAAGACAGCATTAAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-749s21c1
Sequence:CCGGGAAGAGTGAGGGATGGAGAAACTCGAGTTTCTCCATCCCTCACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-491s21c1
Sequence:CCGGATGCGAAGCTCAGGAACTGACCTCGAGGTCAGTTCCTGAGCTTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-144s21c1
Sequence:CCGGATCCAGCCTCAAGTTCGGTTTCTCGAGAAACCGAACTTGAGGCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004502.3-628s21c1
Sequence:CCGGCCTCACGGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCCGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010460
HOXB7 MISSION shRNA Bacterial Glycerol Stock
homeobox B7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2245s1c1
Sequence:CCGGCGAACAAACTTCTTGCGCCTTCTCGAGAAGGCGCAAGAAGTTTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2199s1c1
Sequence:CCGGCTAAATATCCAGCCGCAAGTTCTCGAGAACTTGCGGCTGGATATTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2617s1c1
Sequence:CCGGGCTGGAGAAAGAATTTCACTACTCGAGTAGTGAAATTCTTTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2689s1c1
Sequence:CCGGCCTCACCGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2404s1c1
Sequence:CCGGCGAACCGAGTTCCTTCAACATCTCGAGATGTTGAAGGAACTCGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010460.2-1001s21c1
Sequence:CCGGATGTTGCTAGTAAGGTCTTTGCTCGAGCAAAGACCTTACTAGCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010460.2-726s21c1
Sequence:CCGGAGGAAGAGTGAGGGACAGAGACTCGAGTCTCTGTCCCTCACTCTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010460.2-444s21c1
Sequence:CCGGAGAGTAACTTCCGGATCTACCCTCGAGGGTAGATCCGGAAGTTACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010460.2-795s21c1
Sequence:CCGGTGAAGCATGAAACTCAAATAACTCGAGTTATTTGAGTTTCATGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010460
HOXB7 MISSION shRNA shRNA Plasmid DNA
homeobox B7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2245s1c1
Sequence:CCGGCGAACAAACTTCTTGCGCCTTCTCGAGAAGGCGCAAGAAGTTTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2199s1c1
Sequence:CCGGCTAAATATCCAGCCGCAAGTTCTCGAGAACTTGCGGCTGGATATTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2617s1c1
Sequence:CCGGGCTGGAGAAAGAATTTCACTACTCGAGTAGTGAAATTCTTTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2689s1c1
Sequence:CCGGCCTCACCGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2404s1c1
Sequence:CCGGCGAACCGAGTTCCTTCAACATCTCGAGATGTTGAAGGAACTCGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010460.2-1001s21c1
Sequence:CCGGATGTTGCTAGTAAGGTCTTTGCTCGAGCAAAGACCTTACTAGCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010460.2-726s21c1
Sequence:CCGGAGGAAGAGTGAGGGACAGAGACTCGAGTCTCTGTCCCTCACTCTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010460.2-444s21c1
Sequence:CCGGAGAGTAACTTCCGGATCTACCCTCGAGGGTAGATCCGGAAGTTACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010460.2-795s21c1
Sequence:CCGGTGAAGCATGAAACTCAAATAACTCGAGTTATTTGAGTTTCATGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010460
HOXB7 MISSION shRNA Lentiviral Transduction Particles
homeobox B7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2245s1c1
Sequence:CCGGCGAACAAACTTCTTGCGCCTTCTCGAGAAGGCGCAAGAAGTTTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2199s1c1
Sequence:CCGGCTAAATATCCAGCCGCAAGTTCTCGAGAACTTGCGGCTGGATATTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2617s1c1
Sequence:CCGGGCTGGAGAAAGAATTTCACTACTCGAGTAGTGAAATTCTTTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2689s1c1
Sequence:CCGGCCTCACCGAAAGACAGATCAACTCGAGTTGATCTGTCTTTCGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010460.1-2404s1c1
Sequence:CCGGCGAACCGAGTTCCTTCAACATCTCGAGATGTTGAAGGAACTCGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010460.2-1001s21c1
Sequence:CCGGATGTTGCTAGTAAGGTCTTTGCTCGAGCAAAGACCTTACTAGCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010460.2-726s21c1
Sequence:CCGGAGGAAGAGTGAGGGACAGAGACTCGAGTCTCTGTCCCTCACTCTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010460.2-444s21c1
Sequence:CCGGAGAGTAACTTCCGGATCTACCCTCGAGGGTAGATCCGGAAGTTACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010460.2-795s21c1
Sequence:CCGGTGAAGCATGAAACTCAAATAACTCGAGTTATTTGAGTTTCATGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)