EMAIL THIS PAGE TO A FRIEND

HOXB8

homeobox B8

113 Gene Product Result for
Synonyms: HOX2 HOX2D Hox-2.4
UniProtKB ID: P17481, Q9H1I2
Gene ID:
Human(3218) Summary: This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with colorectal cancer. Mice that have had the murine ortholog of this gene knocked out exhibit an excessive pathologic grooming behavior. This behavior is similar to the behavior of humans suffering from the obsessive-compulsive spectrum disorder trichotillomania. [provided by RefSeq, Jul 2008]
Mouse(15416) homeobox B8
Rat(24457) homeo box B8
chicken(395737) homeobox B8
cow(785855) homeobox B8
dog(491059) homeobox B8
sheep(101120346) homeobox B8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024016 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024016 Rosetta Predictions human pricing
XM_001081339 Rosetta Predictions rat pricing
XM_220888 Rosetta Predictions rat pricing
NM_010461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356441 predicted 716
2 SASI_Hs01_00055002 predicted 381
3 SASI_Hs01_00055004 predicted 612
4 SASI_Hs01_00055005 predicted 489
5 SASI_Hs01_00055006 predicted 508
6 SASI_Hs01_00055007 predicted 724
7 SASI_Hs01_00055009 predicted 521
8 SASI_Hs01_00055010 predicted 510
9 SASI_Hs01_00055011 predicted 660
10 SASI_Hs02_00356442 predicted 388
11 SASI_Hs01_00055003 predicted 538
12 SASI_Hs01_00055008 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371509 predicted 735
2 SASI_Rn02_00371510 predicted 1805
3 SASI_Rn02_00371511 predicted 1811
4 SASI_Rn02_00371512 predicted 495
5 SASI_Rn02_00371513 predicted 920
6 SASI_Rn02_00371514 predicted 939
7 SASI_Rn02_00371515 predicted 1598
8 SASI_Rn02_00371516 predicted 505
9 SASI_Rn02_00371517 predicted 339
10 SASI_Rn02_00371518 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379609 predicted 360
2 SASI_Rn02_00379610 predicted 651
3 SASI_Rn02_00379611 predicted 664
4 SASI_Rn02_00379612 predicted 422
5 SASI_Rn02_00379613 predicted 591
6 SASI_Rn02_00379614 predicted 606
7 SASI_Rn02_00379615 predicted 608
8 SASI_Rn02_00379616 predicted 400
9 SASI_Rn02_00379617 predicted 404
10 SASI_Rn02_00379618 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191104 predicted 1539
2 SASI_Mm02_00318644 predicted 1587
3 SASI_Mm01_00191102 predicted 1608
4 SASI_Mm01_00191103 predicted 1539
5 SASI_Mm01_00191105 predicted 1443
6 SASI_Mm01_00191106 predicted 1545
7 SASI_Mm01_00191107 predicted 1321
8 SASI_Mm01_00191108 predicted 1337
9 SASI_Mm01_00191109 predicted 1549
10 SASI_Mm01_00191110 predicted 1503
11 SASI_Mm01_00191111 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010461
VALIDATED
HOXB8 MISSION shRNA Bacterial Glycerol Stock
homeobox B8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1550s21c1
Sequence:CCGGGTTCCTATTTAATCCCTATCTCTCGAGAGATAGGGATTAAATAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1577s21c1
Sequence:CCGGCAAGCGGAGGATCGAGGTATCCTCGAGGATACCTCGATCCTCCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1680s21c1
Sequence:CCGGGACAAGTTTCCCAGCAGTAAACTCGAGTTTACTGCTGGGAAACTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010461.2-2224s21c1
Sequence:CCGGTGCCTATTCACGCCGTAATTCCTCGAGGAATTACGGCGTGAATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1208s21c1
Sequence:CCGGCCCTTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1207s1c1
Sequence:CCGGCCCTTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010461.1-1549s1c1
Sequence:CCGGGTTCCTATTTAATCCCTATCTCTCGAGAGATAGGGATTAAATAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1303s1c1
Sequence:CCGGCGGCAACTTCTACGGCTACGACTCGAGTCGTAGCCGTAGAAGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1762s1c1
Sequence:CCGGCGATGCGCAGAAGGGTGACAACTCGAGTTGTCACCCTTCTGCGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010461.1-1679s1c1
Sequence:CCGGGACAAGTTTCCCAGCAGTAAACTCGAGTTTACTGCTGGGAAACTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010461
VALIDATED
HOXB8 MISSION shRNA shRNA Plasmid DNA
homeobox B8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1550s21c1
Sequence:CCGGGTTCCTATTTAATCCCTATCTCTCGAGAGATAGGGATTAAATAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1577s21c1
Sequence:CCGGCAAGCGGAGGATCGAGGTATCCTCGAGGATACCTCGATCCTCCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1680s21c1
Sequence:CCGGGACAAGTTTCCCAGCAGTAAACTCGAGTTTACTGCTGGGAAACTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010461.2-2224s21c1
Sequence:CCGGTGCCTATTCACGCCGTAATTCCTCGAGGAATTACGGCGTGAATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1208s21c1
Sequence:CCGGCCCTTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1207s1c1
Sequence:CCGGCCCTTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010461.1-1549s1c1
Sequence:CCGGGTTCCTATTTAATCCCTATCTCTCGAGAGATAGGGATTAAATAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1303s1c1
Sequence:CCGGCGGCAACTTCTACGGCTACGACTCGAGTCGTAGCCGTAGAAGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1762s1c1
Sequence:CCGGCGATGCGCAGAAGGGTGACAACTCGAGTTGTCACCCTTCTGCGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010461.1-1679s1c1
Sequence:CCGGGACAAGTTTCCCAGCAGTAAACTCGAGTTTACTGCTGGGAAACTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010461
VALIDATED
HOXB8 MISSION shRNA Lentiviral Transduction Particles
homeobox B8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1550s21c1
Sequence:CCGGGTTCCTATTTAATCCCTATCTCTCGAGAGATAGGGATTAAATAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1577s21c1
Sequence:CCGGCAAGCGGAGGATCGAGGTATCCTCGAGGATACCTCGATCCTCCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1680s21c1
Sequence:CCGGGACAAGTTTCCCAGCAGTAAACTCGAGTTTACTGCTGGGAAACTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010461.2-2224s21c1
Sequence:CCGGTGCCTATTCACGCCGTAATTCCTCGAGGAATTACGGCGTGAATAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010461.2-1208s21c1
Sequence:CCGGCCCTTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1207s1c1
Sequence:CCGGCCCTTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010461.1-1549s1c1
Sequence:CCGGGTTCCTATTTAATCCCTATCTCTCGAGAGATAGGGATTAAATAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1303s1c1
Sequence:CCGGCGGCAACTTCTACGGCTACGACTCGAGTCGTAGCCGTAGAAGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010461.1-1762s1c1
Sequence:CCGGCGATGCGCAGAAGGGTGACAACTCGAGTTGTCACCCTTCTGCGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010461.1-1679s1c1
Sequence:CCGGGACAAGTTTCCCAGCAGTAAACTCGAGTTTACTGCTGGGAAACTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024016
VALIDATED
HOXB8 MISSION shRNA Bacterial Glycerol Stock
homeobox B8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-1122s21c1
Sequence:CCGGCGCTAGTGGTAGTATCTCGTACTCGAGTACGAGATACTACCACTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-552s21c1
Sequence:CCGGAGTACGCAGACTGCAAGCTTGCTCGAGCAAGCTTGCAGTCTGCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024016.3-943s21c1
Sequence:CCGGCGCGCAGAAGGGCGACAAGAACTCGAGTTCTTGTCGCCCTTCTGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-481s21c1
Sequence:CCGGCGGCAATTTCTACGGCTACGACTCGAGTCGTAGCCGTAGAAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024016.3-754s21c1
Sequence:CCGGTAAGCGGCGAATCGAGGTATCCTCGAGGATACCTCGATTCGCCGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024016.2-1122s1c1
Sequence:CCGGCGCTAGTGGTAGTATCTCGTACTCGAGTACGAGATACTACCACTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024016.2-725s1c1
Sequence:CCGGGAGTTCCTATTTAATCCCTATCTCGAGATAGGGATTAAATAGGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024016.2-297s1c1
Sequence:CCGGCCAATTATTATGACTGCGGCTCTCGAGAGCCGCAGTCATAATAATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024016.2-385s1c1
Sequence:CCGGCCCGTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024016
VALIDATED
HOXB8 MISSION shRNA shRNA Plasmid DNA
homeobox B8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-1122s21c1
Sequence:CCGGCGCTAGTGGTAGTATCTCGTACTCGAGTACGAGATACTACCACTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-552s21c1
Sequence:CCGGAGTACGCAGACTGCAAGCTTGCTCGAGCAAGCTTGCAGTCTGCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024016.3-943s21c1
Sequence:CCGGCGCGCAGAAGGGCGACAAGAACTCGAGTTCTTGTCGCCCTTCTGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-481s21c1
Sequence:CCGGCGGCAATTTCTACGGCTACGACTCGAGTCGTAGCCGTAGAAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024016.3-754s21c1
Sequence:CCGGTAAGCGGCGAATCGAGGTATCCTCGAGGATACCTCGATTCGCCGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024016.2-1122s1c1
Sequence:CCGGCGCTAGTGGTAGTATCTCGTACTCGAGTACGAGATACTACCACTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024016.2-725s1c1
Sequence:CCGGGAGTTCCTATTTAATCCCTATCTCGAGATAGGGATTAAATAGGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024016.2-297s1c1
Sequence:CCGGCCAATTATTATGACTGCGGCTCTCGAGAGCCGCAGTCATAATAATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024016.2-385s1c1
Sequence:CCGGCCCGTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024016
VALIDATED
HOXB8 MISSION shRNA Lentiviral Transduction Particles
homeobox B8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-1122s21c1
Sequence:CCGGCGCTAGTGGTAGTATCTCGTACTCGAGTACGAGATACTACCACTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-552s21c1
Sequence:CCGGAGTACGCAGACTGCAAGCTTGCTCGAGCAAGCTTGCAGTCTGCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024016.3-943s21c1
Sequence:CCGGCGCGCAGAAGGGCGACAAGAACTCGAGTTCTTGTCGCCCTTCTGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024016.3-481s21c1
Sequence:CCGGCGGCAATTTCTACGGCTACGACTCGAGTCGTAGCCGTAGAAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024016.3-754s21c1
Sequence:CCGGTAAGCGGCGAATCGAGGTATCCTCGAGGATACCTCGATTCGCCGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024016.2-1122s1c1
Sequence:CCGGCGCTAGTGGTAGTATCTCGTACTCGAGTACGAGATACTACCACTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024016.2-725s1c1
Sequence:CCGGGAGTTCCTATTTAATCCCTATCTCGAGATAGGGATTAAATAGGAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024016.2-297s1c1
Sequence:CCGGCCAATTATTATGACTGCGGCTCTCGAGAGCCGCAGTCATAATAATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024016.2-385s1c1
Sequence:CCGGCCCGTCGCAAATCCAGGAGTTCTCGAGAACTCCTGGATTTGCGACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)