EMAIL THIS PAGE TO A FRIEND

HOXC10

homeobox C10

83 Gene Product Result for
Synonyms: HOX3I
UniProtKB ID: Q9NYD6, O15219, O15220, Q9BVD5
Gene ID:
Human(3226) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The protein level is controlled during cell differentiation and proliferation, which may indicate this protein has a role in origin activation. [provided by RefSeq, Jul 2008]
Mouse(209448) homeobox C10
Rat(315338) homeo box C10
chicken(770471) homeobox C10
cow(100847795) homeobox C10
dog(486500) homeobox C10
sheep(101122425) homeobox C10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017409 Rosetta Predictions human pricing
XM_001068573 Rosetta Predictions rat pricing
XM_235698 Rosetta Predictions rat pricing
NM_010462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122900 predicted 352
2 SASI_Hs02_00349971 predicted 883
3 SASI_Hs01_00122902 predicted 344
4 SASI_Hs01_00122903 predicted 867
5 SASI_Hs01_00122904 predicted 828
6 SASI_Hs01_00122905 predicted 828
7 SASI_Hs01_00122906 predicted 792
8 SASI_Hs01_00122907 predicted 408
9 SASI_Hs02_00349972 predicted 821
10 SASI_Hs02_00349973 predicted 881
11 SASI_Hs01_00122898 predicted 425
12 SASI_Hs01_00122899 predicted 402
13 SASI_Hs01_00122901 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325010 predicted 2451
2 SASI_Rn02_00325011 predicted 1673
3 SASI_Rn02_00325012 predicted 1756
4 SASI_Rn02_00325013 predicted 2519
5 SASI_Rn02_00325014 predicted 2395
6 SASI_Rn02_00325015 predicted 349
7 SASI_Rn02_00325016 predicted 359
8 SASI_Rn02_00325017 predicted 213
9 SASI_Rn02_00325018 predicted 2522
10 SASI_Rn02_00325019 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389606 predicted 1553
2 SASI_Rn02_00389607 predicted 262
3 SASI_Rn02_00389608 predicted 274
4 SASI_Rn02_00389609 predicted 1575
5 SASI_Rn02_00389610 predicted 1580
6 SASI_Rn02_00389611 predicted 1590
7 SASI_Rn02_00389612 predicted 1450
8 SASI_Rn02_00389613 predicted 1061
9 SASI_Rn02_00389614 predicted 813
10 SASI_Rn02_00389615 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318645 predicted 644
2 SASI_Mm01_00136275 predicted 687
3 SASI_Mm01_00136276 predicted 1340
4 SASI_Mm01_00136277 predicted 768
5 SASI_Mm01_00136278 predicted 724
6 SASI_Mm01_00136279 predicted 418
7 SASI_Mm01_00136280 predicted 328
8 SASI_Mm01_00136281 predicted 297
9 SASI_Mm01_00136282 predicted 285
10 SASI_Mm01_00136283 predicted 1391
11 SASI_Mm01_00136284 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017409
VALIDATED
HOXC10 MISSION shRNA Bacterial Glycerol Stock
homeobox C10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017409.3-199s21c1
Sequence:CCGGAGTCTGGGAGTGACTTCAATTCTCGAGAATTGAAGTCACTCCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017409.3-1662s21c1
Sequence:CCGGCGCTCTAAGAATCTGCTTGAACTCGAGTTCAAGCAGATTCTTAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-993s21c1
Sequence:CCGGCTGGAGATTAGCAAGACCATTCTCGAGAATGGTCTTGCTAATCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-985s1c1
Sequence:CCGGCTGGAGATTAGCAAGACCATTCTCGAGAATGGTCTTGCTAATCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-396s1c1
Sequence:CCGGACCTAGTGTCAAGGAGGAGAACTCGAGTTCTCCTCCTTGACACTAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-820s1c1
Sequence:CCGGACCTCGGATAACGAAGCGAAACTCGAGTTTCGCTTCGTTATCCGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017409.2-1654s1c1
Sequence:CCGGCGCTCTAAGAATCTGCTTGAACTCGAGTTCAAGCAGATTCTTAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-1017s21c1
Sequence:CCGGCTTACAGACAGACAAGTCAAACTCGAGTTTGACTTGTCTGTCTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-404s21c1
Sequence:CCGGACCTAGTGTCAAGGAGGAGAACTCGAGTTCTCCTCCTTGACACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017409
VALIDATED
HOXC10 MISSION shRNA shRNA Plasmid DNA
homeobox C10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017409.3-199s21c1
Sequence:CCGGAGTCTGGGAGTGACTTCAATTCTCGAGAATTGAAGTCACTCCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017409.3-1662s21c1
Sequence:CCGGCGCTCTAAGAATCTGCTTGAACTCGAGTTCAAGCAGATTCTTAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-993s21c1
Sequence:CCGGCTGGAGATTAGCAAGACCATTCTCGAGAATGGTCTTGCTAATCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-985s1c1
Sequence:CCGGCTGGAGATTAGCAAGACCATTCTCGAGAATGGTCTTGCTAATCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-396s1c1
Sequence:CCGGACCTAGTGTCAAGGAGGAGAACTCGAGTTCTCCTCCTTGACACTAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-820s1c1
Sequence:CCGGACCTCGGATAACGAAGCGAAACTCGAGTTTCGCTTCGTTATCCGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017409.2-1654s1c1
Sequence:CCGGCGCTCTAAGAATCTGCTTGAACTCGAGTTCAAGCAGATTCTTAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-1017s21c1
Sequence:CCGGCTTACAGACAGACAAGTCAAACTCGAGTTTGACTTGTCTGTCTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-404s21c1
Sequence:CCGGACCTAGTGTCAAGGAGGAGAACTCGAGTTCTCCTCCTTGACACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017409
VALIDATED
HOXC10 MISSION shRNA Lentiviral Transduction Particles
homeobox C10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017409.3-199s21c1
Sequence:CCGGAGTCTGGGAGTGACTTCAATTCTCGAGAATTGAAGTCACTCCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017409.3-1662s21c1
Sequence:CCGGCGCTCTAAGAATCTGCTTGAACTCGAGTTCAAGCAGATTCTTAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-993s21c1
Sequence:CCGGCTGGAGATTAGCAAGACCATTCTCGAGAATGGTCTTGCTAATCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-985s1c1
Sequence:CCGGCTGGAGATTAGCAAGACCATTCTCGAGAATGGTCTTGCTAATCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-396s1c1
Sequence:CCGGACCTAGTGTCAAGGAGGAGAACTCGAGTTCTCCTCCTTGACACTAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017409.2-820s1c1
Sequence:CCGGACCTCGGATAACGAAGCGAAACTCGAGTTTCGCTTCGTTATCCGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017409.2-1654s1c1
Sequence:CCGGCGCTCTAAGAATCTGCTTGAACTCGAGTTCAAGCAGATTCTTAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-1017s21c1
Sequence:CCGGCTTACAGACAGACAAGTCAAACTCGAGTTTGACTTGTCTGTCTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017409.3-404s21c1
Sequence:CCGGACCTAGTGTCAAGGAGGAGAACTCGAGTTCTCCTCCTTGACACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010462
HOXC10 MISSION shRNA Bacterial Glycerol Stock
homeobox C10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-723s1c1
Sequence:CCGGCACCTCGGATAACGAAGCTAACTCGAGTTAGCTTCGTTATCCGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-301s1c1
Sequence:CCGGCCTAGTGTCAAGGAGGAGAATCTCGAGATTCTCCTCCTTGACACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-949s1c1
Sequence:CCGGCGCAGAATGAAACTCAAGAAACTCGAGTTTCTTGAGTTTCATTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-888s1c1
Sequence:CCGGCCTGGAGATTAGCAAGACCATCTCGAGATGGTCTTGCTAATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-539s1c1
Sequence:CCGGCGCGCACCGAACATCTGGAATCTCGAGATTCCAGATGTTCGGTGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010462
HOXC10 MISSION shRNA shRNA Plasmid DNA
homeobox C10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-723s1c1
Sequence:CCGGCACCTCGGATAACGAAGCTAACTCGAGTTAGCTTCGTTATCCGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-301s1c1
Sequence:CCGGCCTAGTGTCAAGGAGGAGAATCTCGAGATTCTCCTCCTTGACACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-949s1c1
Sequence:CCGGCGCAGAATGAAACTCAAGAAACTCGAGTTTCTTGAGTTTCATTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-888s1c1
Sequence:CCGGCCTGGAGATTAGCAAGACCATCTCGAGATGGTCTTGCTAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-539s1c1
Sequence:CCGGCGCGCACCGAACATCTGGAATCTCGAGATTCCAGATGTTCGGTGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010462
HOXC10 MISSION shRNA Lentiviral Transduction Particles
homeobox C10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-723s1c1
Sequence:CCGGCACCTCGGATAACGAAGCTAACTCGAGTTAGCTTCGTTATCCGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-301s1c1
Sequence:CCGGCCTAGTGTCAAGGAGGAGAATCTCGAGATTCTCCTCCTTGACACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-949s1c1
Sequence:CCGGCGCAGAATGAAACTCAAGAAACTCGAGTTTCTTGAGTTTCATTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-888s1c1
Sequence:CCGGCCTGGAGATTAGCAAGACCATCTCGAGATGGTCTTGCTAATCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010462.1-539s1c1
Sequence:CCGGCGCGCACCGAACATCTGGAATCTCGAGATTCCAGATGTTCGGTGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)