EMAIL THIS PAGE TO A FRIEND

HOXC11

homeobox C11

129 Gene Product Result for
Synonyms: HOX3H
UniProtKB ID: O43248, A8K7D1, Q96DH2
Gene ID:
Human(3227) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene binds to a promoter element of the lactase-phlorizin hydrolase. It also may play a role in early intestinal development. An alternatively spliced variant encoding a shorter isoform has been described but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(109663) homeobox C11
Rat(366996) homeobox C11
chicken(430698) homeobox C11
cow(536141) homeobox C11
dog(100688428) homeobox C11
sheep(101108379) homeobox C11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31960 Anti-HOXC11 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, rat, human, bovine, horse, mouse, yeast, canine
western blot pricing
AV32642 Anti-HOXC11 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat, guinea pig, canine, bovine, horse, human, rabbit
immunohistochemistry, western blot pricing
GW22000F Anti-HOXC11 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
SAB2106457 Anti-HOXC11 antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, guinea pig, horse
western blot pricing
SAB2106458 Anti-HOXC11 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, sheep, rabbit, horse, human
western blot pricing
SAB4100274 Monoclonal Anti-HOXC11 antibody produced in mouse clone HOXC11-A245, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014212 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU212611 MISSION® esiRNA esiRNA targeting mouse Hoxc11 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014212 Rosetta Predictions human pricing
XM_345881 Rosetta Predictions rat pricing
NM_001024842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177509 predicted 1383
2 SASI_Hs01_00177510 predicted 804
3 SASI_Hs01_00177511 predicted 201
4 SASI_Hs01_00177512 predicted 211
5 SASI_Hs01_00177513 predicted 354
6 SASI_Hs01_00177514 predicted 1316
7 SASI_Hs01_00177515 predicted 553
8 SASI_Hs01_00177516 predicted 225
9 SASI_Hs01_00177517 predicted 471
10 SASI_Hs01_00177518 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398787 predicted 350
2 SASI_Rn02_00398788 predicted 354
3 SASI_Rn02_00398789 predicted 211
4 SASI_Rn02_00398790 predicted 349
5 SASI_Rn02_00398791 predicted 546
6 SASI_Rn02_00398792 predicted 507
7 SASI_Rn02_00398793 predicted 429
8 SASI_Rn02_00398794 predicted 452
9 SASI_Rn02_00398795 predicted 270
10 SASI_Rn02_00398796 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056575 predicted 236
2 SASI_Mm01_00056576 predicted 319
3 SASI_Mm01_00056577 predicted 400
4 SASI_Mm01_00056578 predicted 252
5 SASI_Mm01_00056579 predicted 259
6 SASI_Mm01_00056580 predicted 245
7 SASI_Mm01_00056581 predicted 400
8 SASI_Mm01_00056582 predicted 398
9 SASI_Mm01_00056583 predicted 326
10 SASI_Mm01_00056584 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024842
HOXC11 MISSION shRNA Bacterial Glycerol Stock
homeobox C11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-762s1c1
Sequence:CCGGCGTGTACATCAACAAAGAGAACTCGAGTTCTCTTTGTTGATGTACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-705s1c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-111s1c1
Sequence:CCGGCACTTACTACGTGCCTGAGTTCTCGAGAACTCAGGCACGTAGTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-82s21c1
Sequence:CCGGTGCACCTCCAACCTCTATCTGCTCGAGCAGATAGAGGTTGGAGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-260s21c1
Sequence:CCGGACAGCTACTCGTCTTGTTATGCTCGAGCATAACAAGACGAGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-705s21c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-158s21c1
Sequence:CCGGAGGCTCCCTCTCGTCAGATTTCTCGAGAAATCTGACGAGAGGGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-444s21c1
Sequence:CCGGCCAAGCTTTCGACCGCTTCTTCTCGAGAAGAAGCGGTCGAAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024842
HOXC11 MISSION shRNA shRNA Plasmid DNA
homeobox C11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-762s1c1
Sequence:CCGGCGTGTACATCAACAAAGAGAACTCGAGTTCTCTTTGTTGATGTACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-705s1c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-111s1c1
Sequence:CCGGCACTTACTACGTGCCTGAGTTCTCGAGAACTCAGGCACGTAGTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-82s21c1
Sequence:CCGGTGCACCTCCAACCTCTATCTGCTCGAGCAGATAGAGGTTGGAGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-260s21c1
Sequence:CCGGACAGCTACTCGTCTTGTTATGCTCGAGCATAACAAGACGAGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-705s21c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-158s21c1
Sequence:CCGGAGGCTCCCTCTCGTCAGATTTCTCGAGAAATCTGACGAGAGGGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-444s21c1
Sequence:CCGGCCAAGCTTTCGACCGCTTCTTCTCGAGAAGAAGCGGTCGAAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024842
HOXC11 MISSION shRNA Lentiviral Transduction Particles
homeobox C11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-762s1c1
Sequence:CCGGCGTGTACATCAACAAAGAGAACTCGAGTTCTCTTTGTTGATGTACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-705s1c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024842.1-111s1c1
Sequence:CCGGCACTTACTACGTGCCTGAGTTCTCGAGAACTCAGGCACGTAGTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-82s21c1
Sequence:CCGGTGCACCTCCAACCTCTATCTGCTCGAGCAGATAGAGGTTGGAGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-260s21c1
Sequence:CCGGACAGCTACTCGTCTTGTTATGCTCGAGCATAACAAGACGAGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-705s21c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-158s21c1
Sequence:CCGGAGGCTCCCTCTCGTCAGATTTCTCGAGAAATCTGACGAGAGGGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024842.1-444s21c1
Sequence:CCGGCCAAGCTTTCGACCGCTTCTTCTCGAGAAGAAGCGGTCGAAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014212
HOXC11 MISSION shRNA Bacterial Glycerol Stock
homeobox C11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014212.2-1272s1c1
Sequence:CCGGCGAGGCCAAGACTTTGATTTACTCGAGTAAATCAAAGTCTTGGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-802s1c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-502s1c1
Sequence:CCGGCGGCTTCTACTCCTCAGTCAACTCGAGTTGACTGAGGAGTAGAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-199s1c1
Sequence:CCGGGCCCAGTTGCACTTACTACATCTCGAGATGTAGTAAGTGCAACTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-808s1c1
Sequence:CCGGCCCTTATTCGAAATTCCAGATCTCGAGATCTGGAATTTCGAATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014212.3-874s21c1
Sequence:CCGGTCAACGTGTATATCAACAAAGCTCGAGCTTTGTTGATATACACGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014212.3-1389s21c1
Sequence:CCGGCCGAACAATCCTCGAACTAAACTCGAGTTTAGTTCGAGGATTGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014212.3-560s21c1
Sequence:CCGGTCAAGCCTTCGACCGTTTCTTCTCGAGAAGAAACGGTCGAAGGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014212
HOXC11 MISSION shRNA shRNA Plasmid DNA
homeobox C11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014212.2-1272s1c1
Sequence:CCGGCGAGGCCAAGACTTTGATTTACTCGAGTAAATCAAAGTCTTGGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-802s1c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-502s1c1
Sequence:CCGGCGGCTTCTACTCCTCAGTCAACTCGAGTTGACTGAGGAGTAGAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-199s1c1
Sequence:CCGGGCCCAGTTGCACTTACTACATCTCGAGATGTAGTAAGTGCAACTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-808s1c1
Sequence:CCGGCCCTTATTCGAAATTCCAGATCTCGAGATCTGGAATTTCGAATAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014212.3-874s21c1
Sequence:CCGGTCAACGTGTATATCAACAAAGCTCGAGCTTTGTTGATATACACGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014212.3-1389s21c1
Sequence:CCGGCCGAACAATCCTCGAACTAAACTCGAGTTTAGTTCGAGGATTGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014212.3-560s21c1
Sequence:CCGGTCAAGCCTTCGACCGTTTCTTCTCGAGAAGAAACGGTCGAAGGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014212
HOXC11 MISSION shRNA Lentiviral Transduction Particles
homeobox C11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014212.2-1272s1c1
Sequence:CCGGCGAGGCCAAGACTTTGATTTACTCGAGTAAATCAAAGTCTTGGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-802s1c1
Sequence:CCGGGCGCTGCCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGGCAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-502s1c1
Sequence:CCGGCGGCTTCTACTCCTCAGTCAACTCGAGTTGACTGAGGAGTAGAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-199s1c1
Sequence:CCGGGCCCAGTTGCACTTACTACATCTCGAGATGTAGTAAGTGCAACTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014212.2-808s1c1
Sequence:CCGGCCCTTATTCGAAATTCCAGATCTCGAGATCTGGAATTTCGAATAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014212.3-874s21c1
Sequence:CCGGTCAACGTGTATATCAACAAAGCTCGAGCTTTGTTGATATACACGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014212.3-1389s21c1
Sequence:CCGGCCGAACAATCCTCGAACTAAACTCGAGTTTAGTTCGAGGATTGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014212.3-560s21c1
Sequence:CCGGTCAAGCCTTCGACCGTTTCTTCTCGAGAAGAAACGGTCGAAGGCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)