EMAIL THIS PAGE TO A FRIEND

HOXC12

homeobox C12

47 Gene Product Result for
Synonyms: HOC3F HOX3 HOX3F
UniProtKB ID: P31275, Q9BXJ6
Gene ID:
Human(3228) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
Mouse(15421) homeobox C12
Rat(300262) homeo box C12
chicken(429400) homeobox C12
dog(486502) homeobox C12
cow(613573) homeobox C12
sheep(101122680) homeobox C12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013391 MISSION® esiRNA esiRNA targeting mouse Hoxc12 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173860 Rosetta Predictions human pricing
NM_001106796 Rosetta Predictions rat pricing
NM_010463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127365 predicted 195
2 SASI_Hs01_00127366 predicted 134
3 SASI_Hs01_00127367 predicted 732
4 SASI_Hs01_00127368 predicted 688
5 SASI_Hs01_00127369 predicted 733
6 SASI_Hs01_00127370 predicted 647
7 SASI_Hs01_00127371 predicted 730
8 SASI_Hs02_00368740 predicted 810
9 SASI_Hs01_00127373 predicted 690
10 SASI_Hs01_00127374 predicted 509
11 SASI_Hs01_00127372 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222488 predicted 473
2 SASI_Rn02_00222489 predicted 467
3 SASI_Rn02_00222490 predicted 596
4 SASI_Rn02_00222491 predicted 547
5 SASI_Rn02_00222492 predicted 507
6 SASI_Rn02_00222493 predicted 387
7 SASI_Rn02_00222494 predicted 390
8 SASI_Rn02_00222495 predicted 532
9 SASI_Rn02_00222496 predicted 495
10 SASI_Rn02_00222497 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108440 predicted 500
2 SASI_Mm01_00108441 predicted 400
3 SASI_Mm01_00108442 predicted 594
4 SASI_Mm01_00108443 predicted 397
5 SASI_Mm01_00108444 predicted 392
6 SASI_Mm01_00108446 predicted 390
7 SASI_Mm01_00108447 predicted 506
8 SASI_Mm01_00108448 predicted 389
9 SASI_Mm01_00108449 predicted 491
10 SASI_Mm02_00318646 predicted 548
11 SASI_Mm01_00108445 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173860
HOXC12 MISSION shRNA Bacterial Glycerol Stock
homeobox C12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-658s21c1
Sequence:CCGGCCCTATTCGAAGTTGCAACTGCTCGAGCAGTTGCAACTTCGAATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-265s21c1
Sequence:CCGGGAGGACGGCAAGGGTTACTACCTCGAGGTAGTAACCCTTGCCGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-645s21c1
Sequence:CCGGGAAGAAGCGCAAGCCCTATTCCTCGAGGAATAGGGCTTGCGCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-46s21c1
Sequence:CCGGGTAAACATCCACACGGGAGACCTCGAGGTCTCCCGTGTGGATGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-566s21c1
Sequence:CCGGGCTTGGTATCGCCGTTGAACCCTCGAGGGTTCAACGGCGATACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-402s1c1
Sequence:CCGGGCTCGGCTTCAAGTACGACTACTCGAGTAGTCGTACTTGAAGCCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-494s1c1
Sequence:CCGGCGCTGGAATCCGACTCCAGTTCTCGAGAACTGGAGTCGGATTCCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-57s1c1
Sequence:CCGGCACGGGAGACACCTTCTACTTCTCGAGAAGTAGAAGGTGTCTCCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-519s1c1
Sequence:CCGGCCTGCTCAACGAGGGCAACAACTCGAGTTGTTGCCCTCGTTGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-696s1c1
Sequence:CCGGGTTTCTGGTCAACGAGTTCATCTCGAGATGAACTCGTTGACCAGAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173860
HOXC12 MISSION shRNA shRNA Plasmid DNA
homeobox C12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-658s21c1
Sequence:CCGGCCCTATTCGAAGTTGCAACTGCTCGAGCAGTTGCAACTTCGAATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-265s21c1
Sequence:CCGGGAGGACGGCAAGGGTTACTACCTCGAGGTAGTAACCCTTGCCGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-645s21c1
Sequence:CCGGGAAGAAGCGCAAGCCCTATTCCTCGAGGAATAGGGCTTGCGCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-46s21c1
Sequence:CCGGGTAAACATCCACACGGGAGACCTCGAGGTCTCCCGTGTGGATGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-566s21c1
Sequence:CCGGGCTTGGTATCGCCGTTGAACCCTCGAGGGTTCAACGGCGATACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-402s1c1
Sequence:CCGGGCTCGGCTTCAAGTACGACTACTCGAGTAGTCGTACTTGAAGCCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-494s1c1
Sequence:CCGGCGCTGGAATCCGACTCCAGTTCTCGAGAACTGGAGTCGGATTCCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-57s1c1
Sequence:CCGGCACGGGAGACACCTTCTACTTCTCGAGAAGTAGAAGGTGTCTCCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-519s1c1
Sequence:CCGGCCTGCTCAACGAGGGCAACAACTCGAGTTGTTGCCCTCGTTGAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-696s1c1
Sequence:CCGGGTTTCTGGTCAACGAGTTCATCTCGAGATGAACTCGTTGACCAGAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173860
HOXC12 MISSION shRNA Lentiviral Transduction Particles
homeobox C12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-658s21c1
Sequence:CCGGCCCTATTCGAAGTTGCAACTGCTCGAGCAGTTGCAACTTCGAATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-265s21c1
Sequence:CCGGGAGGACGGCAAGGGTTACTACCTCGAGGTAGTAACCCTTGCCGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-645s21c1
Sequence:CCGGGAAGAAGCGCAAGCCCTATTCCTCGAGGAATAGGGCTTGCGCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-46s21c1
Sequence:CCGGGTAAACATCCACACGGGAGACCTCGAGGTCTCCCGTGTGGATGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173860.1-566s21c1
Sequence:CCGGGCTTGGTATCGCCGTTGAACCCTCGAGGGTTCAACGGCGATACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-402s1c1
Sequence:CCGGGCTCGGCTTCAAGTACGACTACTCGAGTAGTCGTACTTGAAGCCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-494s1c1
Sequence:CCGGCGCTGGAATCCGACTCCAGTTCTCGAGAACTGGAGTCGGATTCCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-57s1c1
Sequence:CCGGCACGGGAGACACCTTCTACTTCTCGAGAAGTAGAAGGTGTCTCCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-519s1c1
Sequence:CCGGCCTGCTCAACGAGGGCAACAACTCGAGTTGTTGCCCTCGTTGAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173860.1-696s1c1
Sequence:CCGGGTTTCTGGTCAACGAGTTCATCTCGAGATGAACTCGTTGACCAGAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010463
HOXC12 MISSION shRNA Bacterial Glycerol Stock
homeobox C12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010463.1-404s21c1
Sequence:CCGGTCGGCTTCAAGTACGACTACACTCGAGTGTAGTCGTACTTGAAGCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010463.1-690s21c1
Sequence:CCGGGTTTCTGGTCAACGAGTTCATCTCGAGATGAACTCGTTGACCAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-513s1c1
Sequence:CCGGCCTACTCAACGAGGGCAATAACTCGAGTTATTGCCCTCGTTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-271s1c1
Sequence:CCGGAGCAAGGGTTACTACCGAGAACTCGAGTTCTCGGTAGTAACCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-56s1c1
Sequence:CCGGACACAGGAGACACCTTCTACTCTCGAGAGTAGAAGGTGTCTCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-558s1c1
Sequence:CCGGCTCTCTGGTTTCGCCGTTGAACTCGAGTTCAACGGCGAAACCAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-216s1c1
Sequence:CCGGCGTGTCTCTCAACCCGCCTTTCTCGAGAAAGGCGGGTTGAGAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010463
HOXC12 MISSION shRNA shRNA Plasmid DNA
homeobox C12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010463.1-404s21c1
Sequence:CCGGTCGGCTTCAAGTACGACTACACTCGAGTGTAGTCGTACTTGAAGCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010463.1-690s21c1
Sequence:CCGGGTTTCTGGTCAACGAGTTCATCTCGAGATGAACTCGTTGACCAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-513s1c1
Sequence:CCGGCCTACTCAACGAGGGCAATAACTCGAGTTATTGCCCTCGTTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-271s1c1
Sequence:CCGGAGCAAGGGTTACTACCGAGAACTCGAGTTCTCGGTAGTAACCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-56s1c1
Sequence:CCGGACACAGGAGACACCTTCTACTCTCGAGAGTAGAAGGTGTCTCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-558s1c1
Sequence:CCGGCTCTCTGGTTTCGCCGTTGAACTCGAGTTCAACGGCGAAACCAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-216s1c1
Sequence:CCGGCGTGTCTCTCAACCCGCCTTTCTCGAGAAAGGCGGGTTGAGAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010463
HOXC12 MISSION shRNA Lentiviral Transduction Particles
homeobox C12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010463.1-404s21c1
Sequence:CCGGTCGGCTTCAAGTACGACTACACTCGAGTGTAGTCGTACTTGAAGCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010463.1-690s21c1
Sequence:CCGGGTTTCTGGTCAACGAGTTCATCTCGAGATGAACTCGTTGACCAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-513s1c1
Sequence:CCGGCCTACTCAACGAGGGCAATAACTCGAGTTATTGCCCTCGTTGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-271s1c1
Sequence:CCGGAGCAAGGGTTACTACCGAGAACTCGAGTTCTCGGTAGTAACCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-56s1c1
Sequence:CCGGACACAGGAGACACCTTCTACTCTCGAGAGTAGAAGGTGTCTCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-558s1c1
Sequence:CCGGCTCTCTGGTTTCGCCGTTGAACTCGAGTTCAACGGCGAAACCAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010463.1-216s1c1
Sequence:CCGGCGTGTCTCTCAACCCGCCTTTCTCGAGAAAGGCGGGTTGAGAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)