EMAIL THIS PAGE TO A FRIEND

HOXC13

homeobox C13

135 Gene Product Result for
Synonyms: ECTD9 HOX3 HOX3G
UniProtKB ID: P31276, Q5BL02, Q96J32, Q9NR24, Q9NYD5
Gene ID:
Human(3229) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene may play a role in the development of hair, nail, and filiform papilla. [provided by RefSeq, Jul 2008]
Mouse(15422) homeobox C13
Rat(315337) homeobox C13
chicken(771955) homeobox C13
dog(486503) homeobox C13
cow(538716) homeobox C13
sheep(101108645) homeobox C13
sheep(443261) homeobox C13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017410 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034171 MISSION® esiRNA esiRNA human HOXC13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017410 Rosetta Predictions human pricing
XM_001068426 Rosetta Predictions rat pricing
XM_235695 Rosetta Predictions rat pricing
NM_010464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044654 predicted 1486
2 SASI_Hs01_00044655 predicted 1437
3 SASI_Hs01_00044656 predicted 552
4 SASI_Hs01_00044657 predicted 959
5 SASI_Hs01_00044658 predicted 1494
6 SASI_Hs01_00044659 predicted 1544
7 SASI_Hs01_00044660 predicted 1322
8 SASI_Hs01_00044661 predicted 1145
9 SASI_Hs01_00044662 predicted 1597
10 SASI_Hs01_00044663 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324467 predicted 104
2 SASI_Rn02_00324468 predicted 24
3 SASI_Rn02_00324469 predicted 249
4 SASI_Rn02_00324470 predicted 153
5 SASI_Rn02_00324471 predicted 69
6 SASI_Rn02_00324472 predicted 18
7 SASI_Rn02_00324473 predicted 193
8 SASI_Rn02_00324474 predicted 265
9 SASI_Rn02_00324475 predicted 105
10 SASI_Rn02_00324476 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389596 predicted 430
2 SASI_Rn02_00389597 predicted 489
3 SASI_Rn02_00389598 predicted 475
4 SASI_Rn02_00389599 predicted 709
5 SASI_Rn02_00389600 predicted 738
6 SASI_Rn02_00389601 predicted 666
7 SASI_Rn02_00389602 predicted 656
8 SASI_Rn02_00389603 predicted 421
9 SASI_Rn02_00389604 predicted 480
10 SASI_Rn02_00389605 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060545 predicted 401
2 SASI_Mm02_00318647 predicted 445
3 SASI_Mm01_00060546 predicted 888
4 SASI_Mm01_00060547 predicted 830
5 SASI_Mm01_00060548 predicted 1247
6 SASI_Mm01_00060549 predicted 1133
7 SASI_Mm01_00060550 predicted 760
8 SASI_Mm01_00060551 predicted 1279
9 SASI_Mm01_00060552 predicted 1006
10 SASI_Mm01_00060553 predicted 875
11 SASI_Mm01_00060544 predicted 1424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010464
HOXC13 MISSION shRNA Bacterial Glycerol Stock
homeobox C13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-892s1c1
Sequence:CCGGGCCAGCAAATTCATCACCAAACTCGAGTTTGGTGATGAATTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-954s1c1
Sequence:CCGGGCGTCAGGTCACCATCTGGTTCTCGAGAACCAGATGGTGACCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-667s1c1
Sequence:CCGGGACGCGCTCATCCCTGTTGAACTCGAGTTCAACAGGGATGAGCGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-1009s1c1
Sequence:CCGGAGCAAATCTAAAGCGCCTCATCTCGAGATGAGGCGCTTTAGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-552s1c1
Sequence:CCGGCAGGGCTAAGGAGTTCGCCTTCTCGAGAAGGCGAACTCCTTAGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010464.2-1313s21c1
Sequence:CCGGGTGACTTGTCCCACTAGAAAGCTCGAGCTTTCTAGTGGGACAAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010464.2-1087s21c1
Sequence:CCGGTGTCACAGCTTTGTACCATAACTCGAGTTATGGTACAAAGCTGTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010464
HOXC13 MISSION shRNA shRNA Plasmid DNA
homeobox C13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-892s1c1
Sequence:CCGGGCCAGCAAATTCATCACCAAACTCGAGTTTGGTGATGAATTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-954s1c1
Sequence:CCGGGCGTCAGGTCACCATCTGGTTCTCGAGAACCAGATGGTGACCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-667s1c1
Sequence:CCGGGACGCGCTCATCCCTGTTGAACTCGAGTTCAACAGGGATGAGCGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-1009s1c1
Sequence:CCGGAGCAAATCTAAAGCGCCTCATCTCGAGATGAGGCGCTTTAGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-552s1c1
Sequence:CCGGCAGGGCTAAGGAGTTCGCCTTCTCGAGAAGGCGAACTCCTTAGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010464.2-1313s21c1
Sequence:CCGGGTGACTTGTCCCACTAGAAAGCTCGAGCTTTCTAGTGGGACAAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010464.2-1087s21c1
Sequence:CCGGTGTCACAGCTTTGTACCATAACTCGAGTTATGGTACAAAGCTGTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010464
HOXC13 MISSION shRNA Lentiviral Transduction Particles
homeobox C13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-892s1c1
Sequence:CCGGGCCAGCAAATTCATCACCAAACTCGAGTTTGGTGATGAATTTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-954s1c1
Sequence:CCGGGCGTCAGGTCACCATCTGGTTCTCGAGAACCAGATGGTGACCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-667s1c1
Sequence:CCGGGACGCGCTCATCCCTGTTGAACTCGAGTTCAACAGGGATGAGCGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-1009s1c1
Sequence:CCGGAGCAAATCTAAAGCGCCTCATCTCGAGATGAGGCGCTTTAGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010464.1-552s1c1
Sequence:CCGGCAGGGCTAAGGAGTTCGCCTTCTCGAGAAGGCGAACTCCTTAGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010464.2-1313s21c1
Sequence:CCGGGTGACTTGTCCCACTAGAAAGCTCGAGCTTTCTAGTGGGACAAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010464.2-1087s21c1
Sequence:CCGGTGTCACAGCTTTGTACCATAACTCGAGTTATGGTACAAAGCTGTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017410
HOXC13 MISSION shRNA Bacterial Glycerol Stock
homeobox C13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017410.2-1185s1c1
Sequence:CCGGCGGGTGCAGAAGAGTATTTAACTCGAGTTAAATACTCTTCTGCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017410.2-1073s1c1
Sequence:CCGGAGCAAATCGAAAGCGCCTCATCTCGAGATGAGGCGCTTTCGATTTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017410.2-564s1c1
Sequence:CCGGGCGATAAATACCCGGAGCCGTCTCGAGACGGCTCCGGGTATTTATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1587s21c1
Sequence:CCGGCCGCACTCCTTAGGCAAGATTCTCGAGAATCTTGCCTAAGGAGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1140s21c1
Sequence:CCGGTGTCTCCGCTTTGTACCATAACTCGAGTTATGGTACAAAGCGGAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017410.2-958s21c1
Sequence:CCGGTAGCAAGTTCATCACCAAAGACTCGAGTCTTTGGTGATGAACTTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017410.2-901s21c1
Sequence:CCGGGAAACGCGTGCCCTACACTAACTCGAGTTAGTGTAGGGCACGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1598s21c1
Sequence:CCGGAGGCAAGATTTCCCAGTAAAGCTCGAGCTTTACTGGGAAATCTTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017410
HOXC13 MISSION shRNA shRNA Plasmid DNA
homeobox C13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017410.2-1185s1c1
Sequence:CCGGCGGGTGCAGAAGAGTATTTAACTCGAGTTAAATACTCTTCTGCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017410.2-1073s1c1
Sequence:CCGGAGCAAATCGAAAGCGCCTCATCTCGAGATGAGGCGCTTTCGATTTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017410.2-564s1c1
Sequence:CCGGGCGATAAATACCCGGAGCCGTCTCGAGACGGCTCCGGGTATTTATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1587s21c1
Sequence:CCGGCCGCACTCCTTAGGCAAGATTCTCGAGAATCTTGCCTAAGGAGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1140s21c1
Sequence:CCGGTGTCTCCGCTTTGTACCATAACTCGAGTTATGGTACAAAGCGGAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017410.2-958s21c1
Sequence:CCGGTAGCAAGTTCATCACCAAAGACTCGAGTCTTTGGTGATGAACTTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017410.2-901s21c1
Sequence:CCGGGAAACGCGTGCCCTACACTAACTCGAGTTAGTGTAGGGCACGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1598s21c1
Sequence:CCGGAGGCAAGATTTCCCAGTAAAGCTCGAGCTTTACTGGGAAATCTTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017410
HOXC13 MISSION shRNA Lentiviral Transduction Particles
homeobox C13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017410.2-1185s1c1
Sequence:CCGGCGGGTGCAGAAGAGTATTTAACTCGAGTTAAATACTCTTCTGCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017410.2-1073s1c1
Sequence:CCGGAGCAAATCGAAAGCGCCTCATCTCGAGATGAGGCGCTTTCGATTTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017410.2-564s1c1
Sequence:CCGGGCGATAAATACCCGGAGCCGTCTCGAGACGGCTCCGGGTATTTATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1587s21c1
Sequence:CCGGCCGCACTCCTTAGGCAAGATTCTCGAGAATCTTGCCTAAGGAGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1140s21c1
Sequence:CCGGTGTCTCCGCTTTGTACCATAACTCGAGTTATGGTACAAAGCGGAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017410.2-958s21c1
Sequence:CCGGTAGCAAGTTCATCACCAAAGACTCGAGTCTTTGGTGATGAACTTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017410.2-901s21c1
Sequence:CCGGGAAACGCGTGCCCTACACTAACTCGAGTTAGTGTAGGGCACGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017410.2-1598s21c1
Sequence:CCGGAGGCAAGATTTCCCAGTAAAGCTCGAGCTTTACTGGGAAATCTTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)