EMAIL THIS PAGE TO A FRIEND

HOXC4

homeobox C4

120 Gene Product Result for
Synonyms: HOX3 HOX3E cp19
UniProtKB ID: P09017
Gene ID:
Human(3221) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC4, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants that encode the same protein have been described for HOXC4. Transcript variant one includes the shared exon, and transcript variant two includes only gene-specific exons. [provided by RefSeq, Jul 2008]
Mouse(15423) homeobox C4
Rat(24459) homeo box C4
dog(486498) homeobox C4
cow(613740) homeobox C4
sheep(101108122) homeobox C4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014620 Rosetta Predictions human pricing
NM_153633 Rosetta Predictions human pricing
NM_001109884 Rosetta Predictions rat pricing
XM_001068679 Rosetta Predictions rat pricing
NM_013553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182062 predicted 1143
2 SASI_Hs01_00182063 predicted 1073
3 SASI_Hs01_00182064 predicted 1255
4 SASI_Hs01_00182065 predicted 1071
5 SASI_Hs02_00345916 predicted 1252
6 SASI_Hs01_00182066 predicted 1061
7 SASI_Hs01_00182068 predicted 1175
8 SASI_Hs01_00182069 predicted 1175
9 SASI_Hs01_00182070 predicted 978
10 SASI_Hs01_00182071 predicted 1225
11 SASI_Hs01_00182067 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070592 predicted 510
2 SASI_Hs01_00070593 predicted 440
3 SASI_Hs01_00070594 predicted 628
4 SASI_Hs01_00070595 predicted 438
5 SASI_Hs02_00367373 predicted 623
6 SASI_Hs01_00070596 predicted 420
7 SASI_Hs01_00070598 predicted 540
8 SASI_Hs01_00070599 predicted 538
9 SASI_Hs01_00070600 predicted 345
10 SASI_Hs01_00070601 predicted 584
11 SASI_Hs01_00070597 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250692 predicted 926
2 SASI_Rn02_00250693 predicted 513
3 SASI_Rn02_00250694 predicted 1199
4 SASI_Rn02_00250695 predicted 447
5 SASI_Rn02_00250696 predicted 811
6 SASI_Rn02_00250697 predicted 1207
7 SASI_Rn02_00250698 predicted 440
8 SASI_Rn02_00250699 predicted 462
9 SASI_Rn02_00250700 predicted 972
10 SASI_Rn02_00250701 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325449 predicted 1074
2 SASI_Rn02_00325450 predicted 227
3 SASI_Rn02_00325451 predicted 1171
4 SASI_Rn02_00325452 predicted 777
5 SASI_Rn02_00325453 predicted 860
6 SASI_Rn02_00325454 predicted 1924
7 SASI_Rn02_00325455 predicted 1155
8 SASI_Rn02_00325456 predicted 873
9 SASI_Rn02_00325457 predicted 975
10 SASI_Rn02_00325458 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192493 predicted 826
2 SASI_Mm01_00192494 predicted 414
3 SASI_Mm01_00192495 predicted 356
4 SASI_Mm01_00192496 predicted 707
5 SASI_Mm01_00192497 predicted 338
6 SASI_Mm01_00192499 predicted 368
7 SASI_Mm01_00192500 predicted 869
8 SASI_Mm02_00322282 predicted 598
9 SASI_Mm01_00192501 predicted 519
10 SASI_Mm01_00192502 predicted 498
11 SASI_Mm01_00192498 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014620
HOXC4 MISSION shRNA Bacterial Glycerol Stock
homeobox C4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014620.4-769s21c1
Sequence:CCGGCTGAACACAGTCCGGAATATTCTCGAGAATATTCCGGACTGTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014620.4-712s21c1
Sequence:CCGGACTACATCGATCCGAAATTTCCTCGAGGAAATTTCGGATCGATGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014620.2-1492s1c1
Sequence:CCGGCACACACAAATTGACTCTTATCTCGAGATAAGAGTCAATTTGTGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-704s1c1
Sequence:CCGGCCATGCGAAGAATATTCGCAACTCGAGTTGCGAATATTCTTCGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1195s1c1
Sequence:CCGGCCGAAGGAGAAGGATCGAGATCTCGAGATCTCGATCCTTCTCCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1142s1c1
Sequence:CCGGCGGCAGCAAGTCCTGGAATTACTCGAGTAATTCCAGGACTTGCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1421s1c1
Sequence:CCGGGCAGAGGACATTACCAGGTTACTCGAGTAACCTGGTAATGTCCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014620
HOXC4 MISSION shRNA shRNA Plasmid DNA
homeobox C4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014620.4-769s21c1
Sequence:CCGGCTGAACACAGTCCGGAATATTCTCGAGAATATTCCGGACTGTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014620.4-712s21c1
Sequence:CCGGACTACATCGATCCGAAATTTCCTCGAGGAAATTTCGGATCGATGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014620.2-1492s1c1
Sequence:CCGGCACACACAAATTGACTCTTATCTCGAGATAAGAGTCAATTTGTGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-704s1c1
Sequence:CCGGCCATGCGAAGAATATTCGCAACTCGAGTTGCGAATATTCTTCGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1195s1c1
Sequence:CCGGCCGAAGGAGAAGGATCGAGATCTCGAGATCTCGATCCTTCTCCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1142s1c1
Sequence:CCGGCGGCAGCAAGTCCTGGAATTACTCGAGTAATTCCAGGACTTGCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1421s1c1
Sequence:CCGGGCAGAGGACATTACCAGGTTACTCGAGTAACCTGGTAATGTCCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014620
HOXC4 MISSION shRNA Lentiviral Transduction Particles
homeobox C4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014620.4-769s21c1
Sequence:CCGGCTGAACACAGTCCGGAATATTCTCGAGAATATTCCGGACTGTGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014620.4-712s21c1
Sequence:CCGGACTACATCGATCCGAAATTTCCTCGAGGAAATTTCGGATCGATGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014620.2-1492s1c1
Sequence:CCGGCACACACAAATTGACTCTTATCTCGAGATAAGAGTCAATTTGTGTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-704s1c1
Sequence:CCGGCCATGCGAAGAATATTCGCAACTCGAGTTGCGAATATTCTTCGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1195s1c1
Sequence:CCGGCCGAAGGAGAAGGATCGAGATCTCGAGATCTCGATCCTTCTCCTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1142s1c1
Sequence:CCGGCGGCAGCAAGTCCTGGAATTACTCGAGTAATTCCAGGACTTGCTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014620.2-1421s1c1
Sequence:CCGGGCAGAGGACATTACCAGGTTACTCGAGTAACCTGGTAATGTCCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013553
HOXC4 MISSION shRNA Bacterial Glycerol Stock
homeobox C4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013553.2-1600s21c1
Sequence:CCGGCATCTCTTTCCTTAGGCCTTTCTCGAGAAAGGCCTAAGGAAAGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013553.2-1502s21c1
Sequence:CCGGTGGTCTGGTTTGGGTGAATTTCTCGAGAAATTCACCCAAACCAGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-1099s1c1
Sequence:CCGGGCAGAGGACATCACCAGGTTACTCGAGTAACCTGGTGATGTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-415s1c1
Sequence:CCGGCCTGAACACAGTCCGGAATATCTCGAGATATTCCGGACTGTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-355s1c1
Sequence:CCGGTCTAACTACATCGATCCGAAACTCGAGTTTCGGATCGATGTAGTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-945s1c1
Sequence:CCGGCCGTCGTATGAAATGGAAGAACTCGAGTTCTTCCATTTCATACGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-719s1c1
Sequence:CCGGAGCAACCCATAGTCTACCCTTCTCGAGAAGGGTAGACTATGGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013553
HOXC4 MISSION shRNA shRNA Plasmid DNA
homeobox C4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013553.2-1600s21c1
Sequence:CCGGCATCTCTTTCCTTAGGCCTTTCTCGAGAAAGGCCTAAGGAAAGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013553.2-1502s21c1
Sequence:CCGGTGGTCTGGTTTGGGTGAATTTCTCGAGAAATTCACCCAAACCAGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-1099s1c1
Sequence:CCGGGCAGAGGACATCACCAGGTTACTCGAGTAACCTGGTGATGTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-415s1c1
Sequence:CCGGCCTGAACACAGTCCGGAATATCTCGAGATATTCCGGACTGTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-355s1c1
Sequence:CCGGTCTAACTACATCGATCCGAAACTCGAGTTTCGGATCGATGTAGTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-945s1c1
Sequence:CCGGCCGTCGTATGAAATGGAAGAACTCGAGTTCTTCCATTTCATACGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-719s1c1
Sequence:CCGGAGCAACCCATAGTCTACCCTTCTCGAGAAGGGTAGACTATGGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013553
HOXC4 MISSION shRNA Lentiviral Transduction Particles
homeobox C4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013553.2-1600s21c1
Sequence:CCGGCATCTCTTTCCTTAGGCCTTTCTCGAGAAAGGCCTAAGGAAAGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013553.2-1502s21c1
Sequence:CCGGTGGTCTGGTTTGGGTGAATTTCTCGAGAAATTCACCCAAACCAGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-1099s1c1
Sequence:CCGGGCAGAGGACATCACCAGGTTACTCGAGTAACCTGGTGATGTCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-415s1c1
Sequence:CCGGCCTGAACACAGTCCGGAATATCTCGAGATATTCCGGACTGTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-355s1c1
Sequence:CCGGTCTAACTACATCGATCCGAAACTCGAGTTTCGGATCGATGTAGTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-945s1c1
Sequence:CCGGCCGTCGTATGAAATGGAAGAACTCGAGTTCTTCCATTTCATACGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013553.1-719s1c1
Sequence:CCGGAGCAACCCATAGTCTACCCTTCTCGAGAAGGGTAGACTATGGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)