EMAIL THIS PAGE TO A FRIEND

HOXC5

homeobox C5

119 Gene Product Result for
Synonyms: CP11 HOX3 HOX3D
UniProtKB ID: Q00444
Gene ID:
Human(3222) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Mouse(15424) homeobox C5
Rat(315341) homeo box C5
chicken(100858534) homeobox C5
dog(607625) homeobox C5
cow(100140629) homeobox C5
sheep(101121669) homeobox C5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018953 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018953 Rosetta Predictions human pricing
NR_003084 Rosetta Predictions human pricing
NM_001108116 Rosetta Predictions rat pricing
NM_175730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207101 predicted 570
2 SASI_Hs02_00352425 predicted 643
3 SASI_Hs01_00207102 predicted 609
4 SASI_Hs01_00207104 predicted 1176
5 SASI_Hs01_00207105 predicted 1221
6 SASI_Hs01_00207106 predicted 799
7 SASI_Hs01_00207108 predicted 1198
8 SASI_Hs02_00352426 predicted 625
9 SASI_Hs01_00207110 predicted 1014
10 SASI_Hs02_00352427 predicted 496
11 SASI_Hs01_00207103 predicted 639
12 SASI_Hs01_00207107 predicted 646
13 SASI_Hs01_00207109 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378096 predicted 1328
2 SASI_Hs02_00378097 predicted 1321
3 SASI_Hs02_00378098 predicted 830
4 SASI_Hs02_00378099 predicted 1165
5 SASI_Hs02_00378100 predicted 1210
6 SASI_Hs02_00378101 predicted 1242
7 SASI_Hs02_00378102 predicted 827
8 SASI_Hs02_00378103 predicted 1225
9 SASI_Hs02_00378104 predicted 1331
10 SASI_Hs02_00378105 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235514 predicted 531
2 SASI_Rn02_00235515 predicted 1215
3 SASI_Rn02_00235516 predicted 1190
4 SASI_Rn02_00235517 predicted 604
5 SASI_Rn02_00235518 predicted 1207
6 SASI_Rn02_00235519 predicted 870
7 SASI_Rn02_00235520 predicted 1221
8 SASI_Rn02_00235521 predicted 644
9 SASI_Rn02_00235522 predicted 1195
10 SASI_Rn02_00235523 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121691 predicted 529
2 SASI_Mm01_00121692 predicted 346
3 SASI_Mm02_00346637 predicted 1158
4 SASI_Mm02_00346638 predicted 1226
5 SASI_Mm01_00121693 predicted 1193
6 SASI_Mm01_00121695 predicted 494
7 SASI_Mm01_00121696 predicted 972
8 SASI_Mm02_00346639 predicted 1207
9 SASI_Mm02_00346640 predicted 333
10 SASI_Mm02_00346641 predicted 1241
11 SASI_Mm01_00121694 predicted 623
12 SASI_Mm01_00121697 predicted 1244
13 SASI_Mm01_00121698 predicted 1195
14 SASI_Mm01_00121699 predicted 575
15 SASI_Mm01_00121700 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175730
HOXC5 MISSION shRNA Bacterial Glycerol Stock
homeobox C5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-549s1c1
Sequence:CCGGCCGAACCAGTTACACGCGCTACTCGAGTAGCGCGTGTAACTGGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-124s1c1
Sequence:CCGGCCTGCCTATAACATGCAAACTCTCGAGAGTTTGCATGTTATAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-651s1c1
Sequence:CCGGGTGTCTCAACGAGAGACAGATCTCGAGATCTGTCTCTCGTTGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-627s1c1
Sequence:CCGGGCGCATAGAGATTGCCAACAACTCGAGTTGTTGGCAATCTCTATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175730.5-494s21c1
Sequence:CCGGTTACCCGTGGATGACCAAACTCTCGAGAGTTTGGTCATCCACGGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175730.5-1041s21c1
Sequence:CCGGGTTCAGCTAGCCTGAGTTAAGCTCGAGCTTAACTCAGGCTAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175730
HOXC5 MISSION shRNA shRNA Plasmid DNA
homeobox C5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-549s1c1
Sequence:CCGGCCGAACCAGTTACACGCGCTACTCGAGTAGCGCGTGTAACTGGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-124s1c1
Sequence:CCGGCCTGCCTATAACATGCAAACTCTCGAGAGTTTGCATGTTATAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-651s1c1
Sequence:CCGGGTGTCTCAACGAGAGACAGATCTCGAGATCTGTCTCTCGTTGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-627s1c1
Sequence:CCGGGCGCATAGAGATTGCCAACAACTCGAGTTGTTGGCAATCTCTATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175730.5-494s21c1
Sequence:CCGGTTACCCGTGGATGACCAAACTCTCGAGAGTTTGGTCATCCACGGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175730.5-1041s21c1
Sequence:CCGGGTTCAGCTAGCCTGAGTTAAGCTCGAGCTTAACTCAGGCTAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175730
HOXC5 MISSION shRNA Lentiviral Transduction Particles
homeobox C5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-549s1c1
Sequence:CCGGCCGAACCAGTTACACGCGCTACTCGAGTAGCGCGTGTAACTGGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-124s1c1
Sequence:CCGGCCTGCCTATAACATGCAAACTCTCGAGAGTTTGCATGTTATAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-651s1c1
Sequence:CCGGGTGTCTCAACGAGAGACAGATCTCGAGATCTGTCTCTCGTTGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175730.2-627s1c1
Sequence:CCGGGCGCATAGAGATTGCCAACAACTCGAGTTGTTGGCAATCTCTATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175730.5-494s21c1
Sequence:CCGGTTACCCGTGGATGACCAAACTCTCGAGAGTTTGGTCATCCACGGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175730.5-1041s21c1
Sequence:CCGGGTTCAGCTAGCCTGAGTTAAGCTCGAGCTTAACTCAGGCTAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018953
HOXC5 MISSION shRNA Bacterial Glycerol Stock
homeobox C5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-640s1c1
Sequence:CCGGGCCAACAACTTGTGTCTCAATCTCGAGATTGAGACACAAGTTGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-486s1c1
Sequence:CCGGGCCACAGATTTACCCGTGGATCTCGAGATCCACGGGTAAATCTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018953.2-1310s1c1
Sequence:CCGGGCTCTATGCTTTCCAAACCTTCTCGAGAAGGTTTGGAAAGCATAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-691s1c1
Sequence:CCGGCGCAGGATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATCCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-135s1c1
Sequence:CCGGCATGCAAACTTGTGGGAACTACTCGAGTAGTTCCCACAAGTTTGCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018953.2-1223s21c1
Sequence:CCGGGTGCTTCCTTGTAGCGACTAACTCGAGTTAGTCGCTACAAGGAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018953.2-1224s21c1
Sequence:CCGGTGCTTCCTTGTAGCGACTAAACTCGAGTTTAGTCGCTACAAGGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018953
HOXC5 MISSION shRNA shRNA Plasmid DNA
homeobox C5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-640s1c1
Sequence:CCGGGCCAACAACTTGTGTCTCAATCTCGAGATTGAGACACAAGTTGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-486s1c1
Sequence:CCGGGCCACAGATTTACCCGTGGATCTCGAGATCCACGGGTAAATCTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018953.2-1310s1c1
Sequence:CCGGGCTCTATGCTTTCCAAACCTTCTCGAGAAGGTTTGGAAAGCATAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-691s1c1
Sequence:CCGGCGCAGGATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATCCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-135s1c1
Sequence:CCGGCATGCAAACTTGTGGGAACTACTCGAGTAGTTCCCACAAGTTTGCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018953.2-1223s21c1
Sequence:CCGGGTGCTTCCTTGTAGCGACTAACTCGAGTTAGTCGCTACAAGGAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018953.2-1224s21c1
Sequence:CCGGTGCTTCCTTGTAGCGACTAAACTCGAGTTTAGTCGCTACAAGGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018953
HOXC5 MISSION shRNA Lentiviral Transduction Particles
homeobox C5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-640s1c1
Sequence:CCGGGCCAACAACTTGTGTCTCAATCTCGAGATTGAGACACAAGTTGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-486s1c1
Sequence:CCGGGCCACAGATTTACCCGTGGATCTCGAGATCCACGGGTAAATCTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018953.2-1310s1c1
Sequence:CCGGGCTCTATGCTTTCCAAACCTTCTCGAGAAGGTTTGGAAAGCATAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-691s1c1
Sequence:CCGGCGCAGGATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATCCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018953.2-135s1c1
Sequence:CCGGCATGCAAACTTGTGGGAACTACTCGAGTAGTTCCCACAAGTTTGCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018953.2-1223s21c1
Sequence:CCGGGTGCTTCCTTGTAGCGACTAACTCGAGTTAGTCGCTACAAGGAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018953.2-1224s21c1
Sequence:CCGGTGCTTCCTTGTAGCGACTAAACTCGAGTTTAGTCGCTACAAGGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)