EMAIL THIS PAGE TO A FRIEND

HOXC6

homeobox C6

138 Gene Product Result for
Synonyms: CP25 HHO.C8 HOX3 HOX3C
UniProtKB ID: P09630, B2RBV2, Q6DK09
Gene ID:
Human(3223) Summary: This gene belongs to the homeobox family, members of which encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC6, is one of several HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Alternatively spliced transcript variants encoding different isoforms have been identified for HOXC6. Transcript variant two includes the shared exon, and transcript variant one includes only gene-specific exons. [provided by RefSeq, Jul 2008]
Mouse(15425) homeobox C6
Rat(252885) homeo box C6
chicken(100858368) homeobox C6
dog(486499) homeobox C6
cow(317660) homeobox C6
sheep(443349) homeobox C6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004503 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153791 MISSION® esiRNA esiRNA human HOXC6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004503 Rosetta Predictions human pricing
NM_153693 Rosetta Predictions human pricing
XM_001069410 Rosetta Predictions rat pricing
XM_001069461 Rosetta Predictions rat pricing
XM_345882 Rosetta Predictions rat pricing
NM_010465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236111 predicted 874
2 SASI_Hs01_00236113 predicted 586
3 SASI_Hs01_00236114 predicted 885
4 SASI_Hs01_00236115 predicted 886
5 SASI_Hs01_00236116 predicted 396
6 SASI_Hs01_00236117 predicted 698
7 SASI_Hs01_00236118 predicted 490
8 SASI_Hs01_00236112 predicted 882
9 SASI_Hs02_00337761 predicted 246
10 SASI_Hs02_00337762 predicted 246
11 SASI_Hs01_00236119 predicted 381
12 SASI_Hs01_00236120 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192995 predicted 1266
2 SASI_Hs01_00192997 predicted 982
3 SASI_Hs01_00192998 predicted 1283
4 SASI_Hs01_00192999 predicted 1272
5 SASI_Hs01_00193000 predicted 793
6 SASI_Hs01_00193001 predicted 1091
7 SASI_Hs01_00193002 predicted 879
8 SASI_Hs01_00192996 predicted 1270
9 SASI_Hs02_00367404 predicted 768
10 SASI_Hs02_00367405 predicted 1434
11 SASI_Hs01_00193003 predicted 773
12 SASI_Hs01_00193004 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327877 predicted 374
2 SASI_Rn02_00327878 predicted 436
3 SASI_Rn02_00327879 predicted 1466
4 SASI_Rn02_00327880 predicted 1470
5 SASI_Rn02_00327881 predicted 1496
6 SASI_Rn02_00327882 predicted 1498
7 SASI_Rn02_00327883 predicted 1484
8 SASI_Rn02_00327884 predicted 1617
9 SASI_Rn02_00327885 predicted 1055
10 SASI_Rn02_00327886 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328177 predicted 979
2 SASI_Rn02_00328178 predicted 1037
3 SASI_Rn02_00328179 predicted 1320
4 SASI_Rn02_00328180 predicted 1319
5 SASI_Rn02_00328181 predicted 697
6 SASI_Rn02_00328182 predicted 692
7 SASI_Rn02_00328183 predicted 667
8 SASI_Rn02_00328184 predicted 1308
9 SASI_Rn02_00328185 predicted 1189
10 SASI_Rn02_00328186 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398797 predicted 209
2 SASI_Rn02_00398798 predicted 205
3 SASI_Rn02_00398799 predicted 195
4 SASI_Rn02_00398800 predicted 423
5 SASI_Rn02_00398801 predicted 204
6 SASI_Rn02_00398802 predicted 198
7 SASI_Rn02_00398803 predicted 291
8 SASI_Rn02_00398804 predicted 376
9 SASI_Rn02_00398805 predicted 202
10 SASI_Rn02_00398806 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318648 predicted 256
2 SASI_Mm01_00063400 predicted 244
3 SASI_Mm01_00063401 predicted 239
4 SASI_Mm02_00318649 predicted 328
5 SASI_Mm02_00318650 predicted 213
6 SASI_Mm02_00318651 predicted 384
7 SASI_Mm01_00063406 predicted 210
8 SASI_Mm02_00318652 predicted 416
9 SASI_Mm02_00318653 predicted 1028
10 SASI_Mm02_00318654 predicted 1004
11 SASI_Mm01_00063398 predicted 265
12 SASI_Mm01_00063399 predicted 203
13 SASI_Mm01_00063402 predicted 273
14 SASI_Mm01_00063403 predicted 215
15 SASI_Mm01_00063404 predicted 328
16 SASI_Mm01_00063405 predicted 329
17 SASI_Mm01_00063407 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010465
VALIDATED
HOXC6 MISSION shRNA Bacterial Glycerol Stock
homeobox C6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-324s21c1
Sequence:CCGGCATAACACACAGACCTCAATCCTCGAGGATTGAGGTCTGTGTGTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-639s21c1
Sequence:CCGGGAATCTAATCTCACGTCCACACTCGAGTGTGGACGTGAGATTAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010465.2-134s21c1
Sequence:CCGGCTATGATCCAGTGAGGCATTTCTCGAGAAATGCCTCACTGGATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-249s21c1
Sequence:CCGGCCGTATGACTATGGATCTAATCTCGAGATTAGATCCATAGTCATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010465.2-868s21c1
Sequence:CCGGGGAGTCAGACGTGGACCTAAACTCGAGTTTAGGTCCACGTCTGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-722s1c1
Sequence:CCGGGAATCTAATCTCACGTCCACACTCGAGTGTGGACGTGAGATTAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010465.1-333s1c1
Sequence:CCGGCGTATGACTATGGATCTAATTCTCGAGAATTAGATCCATAGTCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-268s1c1
Sequence:CCGGCCGGATCTACTCGACTCCCTTCTCGAGAAGGGAGTCGAGTAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-635s1c1
Sequence:CCGGCGGCGCATCGAGATCGCCAATCTCGAGATTGGCGATCTCGATGCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010465.1-475s1c1
Sequence:CCGGGAAAGCCAGTATCCAGATTTACTCGAGTAAATCTGGATACTGGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010465
VALIDATED
HOXC6 MISSION shRNA shRNA Plasmid DNA
homeobox C6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-324s21c1
Sequence:CCGGCATAACACACAGACCTCAATCCTCGAGGATTGAGGTCTGTGTGTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-639s21c1
Sequence:CCGGGAATCTAATCTCACGTCCACACTCGAGTGTGGACGTGAGATTAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010465.2-134s21c1
Sequence:CCGGCTATGATCCAGTGAGGCATTTCTCGAGAAATGCCTCACTGGATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-249s21c1
Sequence:CCGGCCGTATGACTATGGATCTAATCTCGAGATTAGATCCATAGTCATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010465.2-868s21c1
Sequence:CCGGGGAGTCAGACGTGGACCTAAACTCGAGTTTAGGTCCACGTCTGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-722s1c1
Sequence:CCGGGAATCTAATCTCACGTCCACACTCGAGTGTGGACGTGAGATTAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010465.1-333s1c1
Sequence:CCGGCGTATGACTATGGATCTAATTCTCGAGAATTAGATCCATAGTCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-268s1c1
Sequence:CCGGCCGGATCTACTCGACTCCCTTCTCGAGAAGGGAGTCGAGTAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-635s1c1
Sequence:CCGGCGGCGCATCGAGATCGCCAATCTCGAGATTGGCGATCTCGATGCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010465.1-475s1c1
Sequence:CCGGGAAAGCCAGTATCCAGATTTACTCGAGTAAATCTGGATACTGGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010465
VALIDATED
HOXC6 MISSION shRNA Lentiviral Transduction Particles
homeobox C6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-324s21c1
Sequence:CCGGCATAACACACAGACCTCAATCCTCGAGGATTGAGGTCTGTGTGTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-639s21c1
Sequence:CCGGGAATCTAATCTCACGTCCACACTCGAGTGTGGACGTGAGATTAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010465.2-134s21c1
Sequence:CCGGCTATGATCCAGTGAGGCATTTCTCGAGAAATGCCTCACTGGATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010465.2-249s21c1
Sequence:CCGGCCGTATGACTATGGATCTAATCTCGAGATTAGATCCATAGTCATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010465.2-868s21c1
Sequence:CCGGGGAGTCAGACGTGGACCTAAACTCGAGTTTAGGTCCACGTCTGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-722s1c1
Sequence:CCGGGAATCTAATCTCACGTCCACACTCGAGTGTGGACGTGAGATTAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010465.1-333s1c1
Sequence:CCGGCGTATGACTATGGATCTAATTCTCGAGAATTAGATCCATAGTCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-268s1c1
Sequence:CCGGCCGGATCTACTCGACTCCCTTCTCGAGAAGGGAGTCGAGTAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010465.1-635s1c1
Sequence:CCGGCGGCGCATCGAGATCGCCAATCTCGAGATTGGCGATCTCGATGCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010465.1-475s1c1
Sequence:CCGGGAAAGCCAGTATCCAGATTTACTCGAGTAAATCTGGATACTGGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004503
VALIDATED
HOXC6 MISSION shRNA Bacterial Glycerol Stock
homeobox C6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-403s21c1
Sequence:CCGGGACCTCAATCGCTCAGGATTTCTCGAGAAATCCTGAGCGATTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004503.3-896s21c1
Sequence:CCGGTATTTATCACTGGCACAATTGCTCGAGCAATTGTGCCAGTGATAAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-459s21c1
Sequence:CCGGAGAAAGCCAGTATCCAGATTTCTCGAGAAATCTGGATACTGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004503.2-1353s1c1
Sequence:CCGGGCCCAGGCAAATTGTATTTAACTCGAGTTAAATACAATTTGCCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-185s1c1
Sequence:CCGGGCCCTCAATTCCACCGCCTATCTCGAGATAGGCGGTGGAATTGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004503.2-403s1c1
Sequence:CCGGGACCTCAATCGCTCAGGATTTCTCGAGAAATCCTGAGCGATTGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-212s1c1
Sequence:CCGGGTGAGGCATTTCTCGACCTATCTCGAGATAGGTCGAGAAATGCCTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-316s1c1
Sequence:CCGGGCCGTATGACTATGGATCTAACTCGAGTTAGATCCATAGTCATACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-243s21c1
Sequence:CCGGTTGCCCAGAACCGGATCTACTCTCGAGAGTAGATCCGGTTCTGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004503
VALIDATED
HOXC6 MISSION shRNA shRNA Plasmid DNA
homeobox C6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-403s21c1
Sequence:CCGGGACCTCAATCGCTCAGGATTTCTCGAGAAATCCTGAGCGATTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004503.3-896s21c1
Sequence:CCGGTATTTATCACTGGCACAATTGCTCGAGCAATTGTGCCAGTGATAAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-459s21c1
Sequence:CCGGAGAAAGCCAGTATCCAGATTTCTCGAGAAATCTGGATACTGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004503.2-1353s1c1
Sequence:CCGGGCCCAGGCAAATTGTATTTAACTCGAGTTAAATACAATTTGCCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-185s1c1
Sequence:CCGGGCCCTCAATTCCACCGCCTATCTCGAGATAGGCGGTGGAATTGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004503.2-403s1c1
Sequence:CCGGGACCTCAATCGCTCAGGATTTCTCGAGAAATCCTGAGCGATTGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-212s1c1
Sequence:CCGGGTGAGGCATTTCTCGACCTATCTCGAGATAGGTCGAGAAATGCCTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-316s1c1
Sequence:CCGGGCCGTATGACTATGGATCTAACTCGAGTTAGATCCATAGTCATACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-243s21c1
Sequence:CCGGTTGCCCAGAACCGGATCTACTCTCGAGAGTAGATCCGGTTCTGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004503
VALIDATED
HOXC6 MISSION shRNA Lentiviral Transduction Particles
homeobox C6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-403s21c1
Sequence:CCGGGACCTCAATCGCTCAGGATTTCTCGAGAAATCCTGAGCGATTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004503.3-896s21c1
Sequence:CCGGTATTTATCACTGGCACAATTGCTCGAGCAATTGTGCCAGTGATAAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-459s21c1
Sequence:CCGGAGAAAGCCAGTATCCAGATTTCTCGAGAAATCTGGATACTGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004503.2-1353s1c1
Sequence:CCGGGCCCAGGCAAATTGTATTTAACTCGAGTTAAATACAATTTGCCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-185s1c1
Sequence:CCGGGCCCTCAATTCCACCGCCTATCTCGAGATAGGCGGTGGAATTGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004503.2-403s1c1
Sequence:CCGGGACCTCAATCGCTCAGGATTTCTCGAGAAATCCTGAGCGATTGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-212s1c1
Sequence:CCGGGTGAGGCATTTCTCGACCTATCTCGAGATAGGTCGAGAAATGCCTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004503.2-316s1c1
Sequence:CCGGGCCGTATGACTATGGATCTAACTCGAGTTAGATCCATAGTCATACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004503.3-243s21c1
Sequence:CCGGTTGCCCAGAACCGGATCTACTCTCGAGAGTAGATCCGGTTCTGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)