EMAIL THIS PAGE TO A FRIEND

HOXC8

homeobox C8

156 Gene Product Result for
Synonyms: HOX3 HOX3A
UniProtKB ID: P31273, A8K4J4, O15221, O15362
Gene ID:
Human(3224) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene may play a role in the regulation of cartilage differentiation. It could also be involved in chondrodysplasias or other cartilage disorders. [provided by RefSeq, Jul 2008]
Mouse(15426) homeobox C8
Rat(24460) homeobox C8
chicken(395711) homeobox C8
dog(607052) homeobox C8
cow(100295249) homeobox C8
sheep(101122179) homeobox C8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501417 Anti-HOXC8 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, bovine
ELISA, western blot pricing
SAB1405959 Anti-HOXC8 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
H1791 Anti-HOXC8 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), western blot pricing
SAB2101076 Anti-HOXC8 antibody produced in rabbit affinity isolated antibody mouse, rabbit, dog, rat, bovine, human, horse, sheep
immunohistochemistry, western blot pricing
HPA028911 Anti-HOXC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
H1916 Anti-HOXC9 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
H2041 Anti-HOXC9 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
WH0003224M1 Monoclonal Anti-HOXC8 antibody produced in mouse clone 5G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403939 Monoclonal Anti-HOXC8 antibody produced in mouse clone 1H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022658 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015971 MISSION® esiRNA esiRNA targeting mouse Hoxc8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022658 Rosetta Predictions human pricing
NM_010466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355917 predicted 1135
2 SASI_Hs01_00113825 predicted 398
3 SASI_Hs01_00113826 predicted 497
4 SASI_Hs01_00113827 predicted 415
5 SASI_Hs01_00113828 predicted 523
6 SASI_Hs01_00113829 predicted 421
7 SASI_Hs02_00355918 predicted 500
8 SASI_Hs01_00113830 predicted 419
9 SASI_Hs01_00113831 predicted 540
10 SASI_Hs02_00355919 predicted 584
11 SASI_Hs01_00113832 predicted 1144
12 SASI_Hs01_00113833 predicted 587
13 SASI_Hs01_00113834 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195727 predicted 424
2 SASI_Mm01_00195728 predicted 560
3 SASI_Mm01_00195729 predicted 483
4 SASI_Mm01_00195730 predicted 613
5 SASI_Mm02_00318655 predicted 586
6 SASI_Mm01_00195731 predicted 481
7 SASI_Mm01_00195732 predicted 553
8 SASI_Mm01_00195733 predicted 563
9 SASI_Mm01_00195734 predicted 481
10 SASI_Mm01_00195735 predicted 620
11 SASI_Mm01_00195736 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010466
HOXC8 MISSION shRNA Bacterial Glycerol Stock
homeobox C8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-713s1c1
Sequence:CCGGCGGTATCAGACCTTGGAACTACTCGAGTAGTTCCAAGGTCTGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-291s1c1
Sequence:CCGGAGTCCCTGGAACCGGCCTATTCTCGAGAATAGGCCGGTTCCAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-698s1c1
Sequence:CCGGCGACAAACTTACAGCCGGTATCTCGAGATACCGGCTGTAAGTTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-738s1c1
Sequence:CCGGAGGAGTTTCTCTTTAATCCTTCTCGAGAAGGATTAAAGAGAAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-610s21c1
Sequence:CCGGCGAAGGACAAGGCCACTTAAACTCGAGTTTAAGTGGCCTTGTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-588s21c1
Sequence:CCGGCCTCCGCCAACACTAACAGTACTCGAGTACTGTTAGTGTTGGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010466.1-1047s21c1
Sequence:CCGGAGAAGTTTACGACTGTCATTTCTCGAGAAATGACAGTCGTAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-436s1c1
Sequence:CCGGCGGCATCTCCAACTCGGGCTACTCGAGTAGCCCGAGTTGGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-699s21c1
Sequence:CCGGGACAAACTTACAGCCGGTATCCTCGAGGATACCGGCTGTAAGTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-740s21c1
Sequence:CCGGGAGTTTCTCTTTAATCCTTATCTCGAGATAAGGATTAAAGAGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010466
HOXC8 MISSION shRNA shRNA Plasmid DNA
homeobox C8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-713s1c1
Sequence:CCGGCGGTATCAGACCTTGGAACTACTCGAGTAGTTCCAAGGTCTGATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-291s1c1
Sequence:CCGGAGTCCCTGGAACCGGCCTATTCTCGAGAATAGGCCGGTTCCAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-698s1c1
Sequence:CCGGCGACAAACTTACAGCCGGTATCTCGAGATACCGGCTGTAAGTTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-738s1c1
Sequence:CCGGAGGAGTTTCTCTTTAATCCTTCTCGAGAAGGATTAAAGAGAAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-610s21c1
Sequence:CCGGCGAAGGACAAGGCCACTTAAACTCGAGTTTAAGTGGCCTTGTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-588s21c1
Sequence:CCGGCCTCCGCCAACACTAACAGTACTCGAGTACTGTTAGTGTTGGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010466.1-1047s21c1
Sequence:CCGGAGAAGTTTACGACTGTCATTTCTCGAGAAATGACAGTCGTAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-436s1c1
Sequence:CCGGCGGCATCTCCAACTCGGGCTACTCGAGTAGCCCGAGTTGGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-699s21c1
Sequence:CCGGGACAAACTTACAGCCGGTATCCTCGAGGATACCGGCTGTAAGTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-740s21c1
Sequence:CCGGGAGTTTCTCTTTAATCCTTATCTCGAGATAAGGATTAAAGAGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010466
HOXC8 MISSION shRNA Lentiviral Transduction Particles
homeobox C8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-713s1c1
Sequence:CCGGCGGTATCAGACCTTGGAACTACTCGAGTAGTTCCAAGGTCTGATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-291s1c1
Sequence:CCGGAGTCCCTGGAACCGGCCTATTCTCGAGAATAGGCCGGTTCCAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-698s1c1
Sequence:CCGGCGACAAACTTACAGCCGGTATCTCGAGATACCGGCTGTAAGTTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-738s1c1
Sequence:CCGGAGGAGTTTCTCTTTAATCCTTCTCGAGAAGGATTAAAGAGAAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-610s21c1
Sequence:CCGGCGAAGGACAAGGCCACTTAAACTCGAGTTTAAGTGGCCTTGTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-588s21c1
Sequence:CCGGCCTCCGCCAACACTAACAGTACTCGAGTACTGTTAGTGTTGGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010466.1-1047s21c1
Sequence:CCGGAGAAGTTTACGACTGTCATTTCTCGAGAAATGACAGTCGTAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010466.1-436s1c1
Sequence:CCGGCGGCATCTCCAACTCGGGCTACTCGAGTAGCCCGAGTTGGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-699s21c1
Sequence:CCGGGACAAACTTACAGCCGGTATCCTCGAGGATACCGGCTGTAAGTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010466.1-740s21c1
Sequence:CCGGGAGTTTCTCTTTAATCCTTATCTCGAGATAAGGATTAAAGAGAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022658
HOXC8 MISSION shRNA Bacterial Glycerol Stock
homeobox C8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-431s1c1
Sequence:CCGGCGCCTCCAAATTCTATGGCTACTCGAGTAGCCATAGAATTTGGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-636s1c1
Sequence:CCGGCGGCAAACTTACAGCCGGTATCTCGAGATACCGGCTGTAAGTTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-531s1c1
Sequence:CCGGGCCAACACTAACAGTAGCGAACTCGAGTTCGCTACTGTTAGTGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-711s1c1
Sequence:CCGGCGTCGGATTGAAGTCTCTCATCTCGAGATGAGAGACTTCAATCCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022658.3-1975s1c1
Sequence:CCGGGCTGCTTATTTCACTAAGAAACTCGAGTTTCTTAGTGAAATAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022658.3-935s21c1
Sequence:CCGGTAGCAACTCCCTTGAAGTTTCCTCGAGGAAACTTCAAGGGAGTTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022658.3-504s21c1
Sequence:CCGGGTGCAATATCCCGACTGTAAACTCGAGTTTACAGTCGGGATATTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022658
HOXC8 MISSION shRNA shRNA Plasmid DNA
homeobox C8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-431s1c1
Sequence:CCGGCGCCTCCAAATTCTATGGCTACTCGAGTAGCCATAGAATTTGGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-636s1c1
Sequence:CCGGCGGCAAACTTACAGCCGGTATCTCGAGATACCGGCTGTAAGTTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-531s1c1
Sequence:CCGGGCCAACACTAACAGTAGCGAACTCGAGTTCGCTACTGTTAGTGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-711s1c1
Sequence:CCGGCGTCGGATTGAAGTCTCTCATCTCGAGATGAGAGACTTCAATCCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022658.3-1975s1c1
Sequence:CCGGGCTGCTTATTTCACTAAGAAACTCGAGTTTCTTAGTGAAATAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022658.3-935s21c1
Sequence:CCGGTAGCAACTCCCTTGAAGTTTCCTCGAGGAAACTTCAAGGGAGTTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022658.3-504s21c1
Sequence:CCGGGTGCAATATCCCGACTGTAAACTCGAGTTTACAGTCGGGATATTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022658
HOXC8 MISSION shRNA Lentiviral Transduction Particles
homeobox C8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-431s1c1
Sequence:CCGGCGCCTCCAAATTCTATGGCTACTCGAGTAGCCATAGAATTTGGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-636s1c1
Sequence:CCGGCGGCAAACTTACAGCCGGTATCTCGAGATACCGGCTGTAAGTTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-531s1c1
Sequence:CCGGGCCAACACTAACAGTAGCGAACTCGAGTTCGCTACTGTTAGTGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022658.3-711s1c1
Sequence:CCGGCGTCGGATTGAAGTCTCTCATCTCGAGATGAGAGACTTCAATCCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022658.3-1975s1c1
Sequence:CCGGGCTGCTTATTTCACTAAGAAACTCGAGTTTCTTAGTGAAATAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022658.3-935s21c1
Sequence:CCGGTAGCAACTCCCTTGAAGTTTCCTCGAGGAAACTTCAAGGGAGTTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022658.3-504s21c1
Sequence:CCGGGTGCAATATCCCGACTGTAAACTCGAGTTTACAGTCGGGATATTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)