EMAIL THIS PAGE TO A FRIEND

HOXC9

homeobox C9

95 Gene Product Result for
Synonyms: HOX3 HOX3B
UniProtKB ID: P31274, B2RCN7, Q9H1I0
Gene ID:
Human(3225) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
Mouse(15427) homeobox C9
Rat(368178) homeobox C9
chicken(425723) homeobox C9
cow(100295214) homeobox C9
sheep(443360) homeobox C9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301906 Anti-HOXC9 affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
AV35813 Anti-HOXC9 (AB1) antibody produced in rabbit IgG fraction of antiserum human, horse, mouse, rat, sheep, goat, rabbit
immunohistochemistry, western blot pricing
AV35814 Anti-HOXC9 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rabbit, human, rat
western blot pricing
AV38876 Anti-HOXC9 (AB3) antibody produced in rabbit IgG fraction of antiserum rabbit, rat, guinea pig, horse, mouse, human
western blot pricing
H1916 Anti-HOXC9 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
H2041 Anti-HOXC9 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
HPA063965 Anti-HOXC9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA072160 Anti-HOXC9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1302579 ANTI-MOUSE HOXC9 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
WH0003225M1 Monoclonal Anti-HOXC9 antibody produced in mouse clone 2B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006897 Rosetta Predictions human pricing
XM_347335 Rosetta Predictions rat pricing
NM_008272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179815 predicted 440
2 SASI_Hs01_00179816 predicted 260
3 SASI_Hs01_00179817 predicted 221
4 SASI_Hs01_00179818 predicted 216
5 SASI_Hs01_00179819 predicted 305
6 SASI_Hs01_00179820 predicted 259
7 SASI_Hs01_00179821 predicted 207
8 SASI_Hs01_00179822 predicted 219
9 SASI_Hs02_00342573 predicted 582
10 SASI_Hs01_00179824 predicted 216
11 SASI_Hs01_00179823 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399656 predicted 1697
2 SASI_Rn02_00399657 predicted 1698
3 SASI_Rn02_00399658 predicted 1615
4 SASI_Rn02_00399659 predicted 1778
5 SASI_Rn02_00399660 predicted 1746
6 SASI_Rn02_00399661 predicted 1725
7 SASI_Rn02_00399662 predicted 1588
8 SASI_Rn02_00399663 predicted 1681
9 SASI_Rn02_00399664 predicted 1751
10 SASI_Rn02_00399665 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313508 predicted 1257
2 SASI_Mm01_00146534 predicted 978
3 SASI_Mm01_00146535 predicted 1030
4 SASI_Mm01_00146537 predicted 1037
5 SASI_Mm01_00146541 predicted 1179
6 SASI_Mm01_00146543 predicted 907
7 SASI_Mm01_00146538 predicted 693
8 SASI_Mm01_00146539 predicted 689
9 SASI_Mm01_00146540 predicted 668
10 SASI_Mm02_00313509 predicted 753
11 SASI_Mm01_00146536 predicted 1322
12 SASI_Mm01_00146542 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006897
VALIDATED
HOXC9 MISSION shRNA Bacterial Glycerol Stock
homeobox C9
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-819s21c1
Sequence:CCGGGAATCGAAGGATGAAGATGAACTCGAGTTCATCTTCATCCTTCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-362s21c1
Sequence:CCGGACACGCGCTACATGCGGACTTCTCGAGAAGTCCGCATGTAGCGCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-224s21c1
Sequence:CCGGTGGTGCCGGACTGTAGCGATTCTCGAGAATCGCTACAGTCCGGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006897.1-1054s21c1
Sequence:CCGGAGGGTTCAGTGTTGAGATATTCTCGAGAATATCTCAACACTGAACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-869s21c1
Sequence:CCGGAGCAGTCCTAAACCCTACCCACTCGAGTGGGTAGGGTTTAGGACTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006897.1-1042s21c1
Sequence:CCGGTTGCGATTTGGGAGGGTTCAGCTCGAGCTGAACCCTCCCAAATCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006897.1-1202s1c1
Sequence:CCGGCCAGTACTTGAATCGCTATATCTCGAGATATAGCGATTCAAGTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006897.1-774s1c1
Sequence:CCGGCCGGGTTCTCAATCTCACCGACTCGAGTCGGTGAGATTGAGAACCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006897.1-315s1c1
Sequence:CCGGGTCCGTGGTATATCACCCGTACTCGAGTACGGGTGATATACCACGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006897.1-501s1c1
Sequence:CCGGCCGCAGCTACCCGGACTACATCTCGAGATGTAGTCCGGGTAGCTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006897.1-139s1c1
Sequence:CCGGCTCATCTCTCACGACAATGAACTCGAGTTCATTGTCGTGAGAGATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006897
VALIDATED
HOXC9 MISSION shRNA shRNA Plasmid DNA
homeobox C9
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-819s21c1
Sequence:CCGGGAATCGAAGGATGAAGATGAACTCGAGTTCATCTTCATCCTTCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-362s21c1
Sequence:CCGGACACGCGCTACATGCGGACTTCTCGAGAAGTCCGCATGTAGCGCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-224s21c1
Sequence:CCGGTGGTGCCGGACTGTAGCGATTCTCGAGAATCGCTACAGTCCGGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006897.1-1054s21c1
Sequence:CCGGAGGGTTCAGTGTTGAGATATTCTCGAGAATATCTCAACACTGAACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-869s21c1
Sequence:CCGGAGCAGTCCTAAACCCTACCCACTCGAGTGGGTAGGGTTTAGGACTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006897.1-1042s21c1
Sequence:CCGGTTGCGATTTGGGAGGGTTCAGCTCGAGCTGAACCCTCCCAAATCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006897.1-1202s1c1
Sequence:CCGGCCAGTACTTGAATCGCTATATCTCGAGATATAGCGATTCAAGTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006897.1-774s1c1
Sequence:CCGGCCGGGTTCTCAATCTCACCGACTCGAGTCGGTGAGATTGAGAACCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006897.1-315s1c1
Sequence:CCGGGTCCGTGGTATATCACCCGTACTCGAGTACGGGTGATATACCACGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006897.1-501s1c1
Sequence:CCGGCCGCAGCTACCCGGACTACATCTCGAGATGTAGTCCGGGTAGCTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006897.1-139s1c1
Sequence:CCGGCTCATCTCTCACGACAATGAACTCGAGTTCATTGTCGTGAGAGATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006897
VALIDATED
HOXC9 MISSION shRNA Lentiviral Transduction Particles
homeobox C9
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-819s21c1
Sequence:CCGGGAATCGAAGGATGAAGATGAACTCGAGTTCATCTTCATCCTTCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-362s21c1
Sequence:CCGGACACGCGCTACATGCGGACTTCTCGAGAAGTCCGCATGTAGCGCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-224s21c1
Sequence:CCGGTGGTGCCGGACTGTAGCGATTCTCGAGAATCGCTACAGTCCGGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006897.1-1054s21c1
Sequence:CCGGAGGGTTCAGTGTTGAGATATTCTCGAGAATATCTCAACACTGAACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006897.1-869s21c1
Sequence:CCGGAGCAGTCCTAAACCCTACCCACTCGAGTGGGTAGGGTTTAGGACTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006897.1-1042s21c1
Sequence:CCGGTTGCGATTTGGGAGGGTTCAGCTCGAGCTGAACCCTCCCAAATCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006897.1-1202s1c1
Sequence:CCGGCCAGTACTTGAATCGCTATATCTCGAGATATAGCGATTCAAGTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006897.1-774s1c1
Sequence:CCGGCCGGGTTCTCAATCTCACCGACTCGAGTCGGTGAGATTGAGAACCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006897.1-315s1c1
Sequence:CCGGGTCCGTGGTATATCACCCGTACTCGAGTACGGGTGATATACCACGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006897.1-501s1c1
Sequence:CCGGCCGCAGCTACCCGGACTACATCTCGAGATGTAGTCCGGGTAGCTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006897.1-139s1c1
Sequence:CCGGCTCATCTCTCACGACAATGAACTCGAGTTCATTGTCGTGAGAGATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008272
HOXC9 MISSION shRNA Bacterial Glycerol Stock
homeobox C9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008272.3-1231s21c1
Sequence:CCGGCAAGTACCAGACGCTGGAACTCTCGAGAGTTCCAGCGTCTGGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008272.3-672s21c1
Sequence:CCGGCGCTCATCTCTCACGACAATGCTCGAGCATTGTCGTGAGAGATGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008272.3-1512s21c1
Sequence:CCGGAGGAAAGAACAAGATAGAGAACTCGAGTTCTCTATCTTGTTCTTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1192s1c1
Sequence:CCGGCGCCCGTTCCACAAGGAAGAACTCGAGTTCTTCCTTGTGGAACGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-804s1c1
Sequence:CCGGCGGCTGTATTCAGTACGTCGTCTCGAGACGACGTACTGAATACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1306s1c1
Sequence:CCGGCCGTGTTCTCAATCTCACTGACTCGAGTCAGTGAGATTGAGAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-847s1c1
Sequence:CCGGGTCTGTGGTCTATCACCCTTACTCGAGTAAGGGTGATAGACCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1292s1c1
Sequence:CCGGCGGTACGAGGTGGCCCGTGTTCTCGAGAACACGGGCCACCTCGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008272
HOXC9 MISSION shRNA shRNA Plasmid DNA
homeobox C9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008272.3-1231s21c1
Sequence:CCGGCAAGTACCAGACGCTGGAACTCTCGAGAGTTCCAGCGTCTGGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008272.3-672s21c1
Sequence:CCGGCGCTCATCTCTCACGACAATGCTCGAGCATTGTCGTGAGAGATGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008272.3-1512s21c1
Sequence:CCGGAGGAAAGAACAAGATAGAGAACTCGAGTTCTCTATCTTGTTCTTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1192s1c1
Sequence:CCGGCGCCCGTTCCACAAGGAAGAACTCGAGTTCTTCCTTGTGGAACGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-804s1c1
Sequence:CCGGCGGCTGTATTCAGTACGTCGTCTCGAGACGACGTACTGAATACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1306s1c1
Sequence:CCGGCCGTGTTCTCAATCTCACTGACTCGAGTCAGTGAGATTGAGAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-847s1c1
Sequence:CCGGGTCTGTGGTCTATCACCCTTACTCGAGTAAGGGTGATAGACCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1292s1c1
Sequence:CCGGCGGTACGAGGTGGCCCGTGTTCTCGAGAACACGGGCCACCTCGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008272
HOXC9 MISSION shRNA Lentiviral Transduction Particles
homeobox C9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008272.3-1231s21c1
Sequence:CCGGCAAGTACCAGACGCTGGAACTCTCGAGAGTTCCAGCGTCTGGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008272.3-672s21c1
Sequence:CCGGCGCTCATCTCTCACGACAATGCTCGAGCATTGTCGTGAGAGATGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008272.3-1512s21c1
Sequence:CCGGAGGAAAGAACAAGATAGAGAACTCGAGTTCTCTATCTTGTTCTTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1192s1c1
Sequence:CCGGCGCCCGTTCCACAAGGAAGAACTCGAGTTCTTCCTTGTGGAACGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-804s1c1
Sequence:CCGGCGGCTGTATTCAGTACGTCGTCTCGAGACGACGTACTGAATACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1306s1c1
Sequence:CCGGCCGTGTTCTCAATCTCACTGACTCGAGTCAGTGAGATTGAGAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-847s1c1
Sequence:CCGGGTCTGTGGTCTATCACCCTTACTCGAGTAAGGGTGATAGACCACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008272.2-1292s1c1
Sequence:CCGGCGGTACGAGGTGGCCCGTGTTCTCGAGAACACGGGCCACCTCGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)