EMAIL THIS PAGE TO A FRIEND

HOXD10

homeobox D10

102 Gene Product Result for
Synonyms: HOX4 HOX4D HOX4E Hox-4.4
UniProtKB ID: P28358, Q6NT10
Gene ID:
Human(3236) Summary: This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox D genes located on chromosome 2. The encoded nuclear protein functions as a sequence-specific transcription factor that is expressed in the developing limb buds and is involved in differentiation and limb development. Mutations in this gene have been associated with Wilm's tumor and congenital vertical talus (also known as 'rocker-bottom foot' deformity or congenital convex pes valgus) and/or a foot deformity resembling that seen in Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
Mouse(15430) homeobox D10
Rat(303991) homeo box D10
sheep(101106824) homeobox D10
chicken(771246) homeobox D10
dog(488415) homeobox D10
Horse(100066123) homeobox D10
cow(540251) homeobox D10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002148 Rosetta Predictions human pricing
NM_001107094 Rosetta Predictions rat pricing
NM_013554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016157 predicted 262
2 SASI_Hs01_00016158 predicted 827
3 SASI_Hs02_00333333 predicted 276
4 SASI_Hs01_00016159 predicted 589
5 SASI_Hs01_00016161 predicted 372
6 SASI_Hs01_00016162 predicted 329
7 SASI_Hs01_00016163 predicted 724
8 SASI_Hs01_00016164 predicted 317
9 SASI_Hs01_00016165 predicted 587
10 SASI_Hs01_00016166 predicted 522
11 SASI_Hs01_00016160 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225436 predicted 341
2 SASI_Rn02_00225437 predicted 614
3 SASI_Rn02_00225438 predicted 397
4 SASI_Rn02_00225439 predicted 362
5 SASI_Rn02_00225440 predicted 367
6 SASI_Rn02_00225441 predicted 895
7 SASI_Rn02_00225442 predicted 726
8 SASI_Rn02_00225443 predicted 870
9 SASI_Rn02_00225444 predicted 409
10 SASI_Rn02_00225445 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196519 predicted 255
2 SASI_Mm01_00196520 predicted 532
3 SASI_Mm01_00196521 predicted 849
4 SASI_Mm01_00196522 predicted 813
5 SASI_Mm01_00196524 predicted 268
6 SASI_Mm01_00196525 predicted 277
7 SASI_Mm01_00196526 predicted 634
8 SASI_Mm02_00322283 predicted 524
9 SASI_Mm01_00196527 predicted 770
10 SASI_Mm01_00196528 predicted 322
11 SASI_Mm01_00196523 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013554
HOXD10 MISSION shRNA Bacterial Glycerol Stock
homeobox D10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013554.4-1131s21c1
Sequence:CCGGGCGGAAACAAACCCTTCATTGCTCGAGCAATGAAGGGTTTGTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013554.4-1316s21c1
Sequence:CCGGTCGTAATGCAGGGTAACTATTCTCGAGAATAGTTACCCTGCATTACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013554.4-385s21c1
Sequence:CCGGATAAGCGCAACAAACTCATTTCTCGAGAAATGAGTTTGTTGCGCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-361s1c1
Sequence:CCGGCCGCCAACATTAAAGAAGAATCTCGAGATTCTTCTTTAATGTTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-872s1c1
Sequence:CCGGCAAGCACCAAACGCTGGAATTCTCGAGAATTCCAGCGTTTGGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-458s1c1
Sequence:CCGGCGAGTCTTGTCCTGTTGAGAACTCGAGTTCTCAACAGGACAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-941s1c1
Sequence:CCGGAGAGATCAGTAAGAGCGTTAACTCGAGTTAACGCTCTTACTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-299s1c1
Sequence:CCGGCCCGAACAGATCTTGTCGAATCTCGAGATTCGACAAGATCTGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013554
HOXD10 MISSION shRNA shRNA Plasmid DNA
homeobox D10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013554.4-1131s21c1
Sequence:CCGGGCGGAAACAAACCCTTCATTGCTCGAGCAATGAAGGGTTTGTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013554.4-1316s21c1
Sequence:CCGGTCGTAATGCAGGGTAACTATTCTCGAGAATAGTTACCCTGCATTACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013554.4-385s21c1
Sequence:CCGGATAAGCGCAACAAACTCATTTCTCGAGAAATGAGTTTGTTGCGCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-361s1c1
Sequence:CCGGCCGCCAACATTAAAGAAGAATCTCGAGATTCTTCTTTAATGTTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-872s1c1
Sequence:CCGGCAAGCACCAAACGCTGGAATTCTCGAGAATTCCAGCGTTTGGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-458s1c1
Sequence:CCGGCGAGTCTTGTCCTGTTGAGAACTCGAGTTCTCAACAGGACAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-941s1c1
Sequence:CCGGAGAGATCAGTAAGAGCGTTAACTCGAGTTAACGCTCTTACTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-299s1c1
Sequence:CCGGCCCGAACAGATCTTGTCGAATCTCGAGATTCGACAAGATCTGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013554
HOXD10 MISSION shRNA Lentiviral Transduction Particles
homeobox D10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013554.4-1131s21c1
Sequence:CCGGGCGGAAACAAACCCTTCATTGCTCGAGCAATGAAGGGTTTGTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013554.4-1316s21c1
Sequence:CCGGTCGTAATGCAGGGTAACTATTCTCGAGAATAGTTACCCTGCATTACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013554.4-385s21c1
Sequence:CCGGATAAGCGCAACAAACTCATTTCTCGAGAAATGAGTTTGTTGCGCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-361s1c1
Sequence:CCGGCCGCCAACATTAAAGAAGAATCTCGAGATTCTTCTTTAATGTTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-872s1c1
Sequence:CCGGCAAGCACCAAACGCTGGAATTCTCGAGAATTCCAGCGTTTGGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-458s1c1
Sequence:CCGGCGAGTCTTGTCCTGTTGAGAACTCGAGTTCTCAACAGGACAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-941s1c1
Sequence:CCGGAGAGATCAGTAAGAGCGTTAACTCGAGTTAACGCTCTTACTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013554.2-299s1c1
Sequence:CCGGCCCGAACAGATCTTGTCGAATCTCGAGATTCGACAAGATCTGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002148
VALIDATED
HOXD10 MISSION shRNA Bacterial Glycerol Stock
homeobox D10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-962s21c1
Sequence:CCGGGAGATCAGTAAGAGCGTTAACCTCGAGGTTAACGCTCTTACTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-415s21c1
Sequence:CCGGGTATTCTGATAAGCGCAACAACTCGAGTTGTTGCGCTTATCAGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-320s21c1
Sequence:CCGGCCGAACAGATCTTGTCGAATACTCGAGTATTCGACAAGATCTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-1361s21c1
Sequence:CCGGTCGTAATGCAGGGTAACTATTCTCGAGAATAGTTACCCTGCATTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-987s21c1
Sequence:CCGGCCGACAGGCAGGTCAAGATTTCTCGAGAAATCTTGACCTGCCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-407s1c1
Sequence:CCGGGTATTCTGATAAGCGCAACAACTCGAGTTGTTGCGCTTATCAGAATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002148.2-373s1c1
Sequence:CCGGCCACCAACATTAAGGAAGAATCTCGAGATTCTTCCTTAATGTTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-312s1c1
Sequence:CCGGCCGAACAGATCTTGTCGAATACTCGAGTATTCGACAAGATCTGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-1265s1c1
Sequence:CCGGGCAAGTGATCTGTAATCCCTACTCGAGTAGGGATTACAGATCACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002148
VALIDATED
HOXD10 MISSION shRNA shRNA Plasmid DNA
homeobox D10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-962s21c1
Sequence:CCGGGAGATCAGTAAGAGCGTTAACCTCGAGGTTAACGCTCTTACTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-415s21c1
Sequence:CCGGGTATTCTGATAAGCGCAACAACTCGAGTTGTTGCGCTTATCAGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-320s21c1
Sequence:CCGGCCGAACAGATCTTGTCGAATACTCGAGTATTCGACAAGATCTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-1361s21c1
Sequence:CCGGTCGTAATGCAGGGTAACTATTCTCGAGAATAGTTACCCTGCATTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-987s21c1
Sequence:CCGGCCGACAGGCAGGTCAAGATTTCTCGAGAAATCTTGACCTGCCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-407s1c1
Sequence:CCGGGTATTCTGATAAGCGCAACAACTCGAGTTGTTGCGCTTATCAGAATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002148.2-373s1c1
Sequence:CCGGCCACCAACATTAAGGAAGAATCTCGAGATTCTTCCTTAATGTTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-312s1c1
Sequence:CCGGCCGAACAGATCTTGTCGAATACTCGAGTATTCGACAAGATCTGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-1265s1c1
Sequence:CCGGGCAAGTGATCTGTAATCCCTACTCGAGTAGGGATTACAGATCACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002148
VALIDATED
HOXD10 MISSION shRNA Lentiviral Transduction Particles
homeobox D10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-962s21c1
Sequence:CCGGGAGATCAGTAAGAGCGTTAACCTCGAGGTTAACGCTCTTACTGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-415s21c1
Sequence:CCGGGTATTCTGATAAGCGCAACAACTCGAGTTGTTGCGCTTATCAGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-320s21c1
Sequence:CCGGCCGAACAGATCTTGTCGAATACTCGAGTATTCGACAAGATCTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-1361s21c1
Sequence:CCGGTCGTAATGCAGGGTAACTATTCTCGAGAATAGTTACCCTGCATTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002148.3-987s21c1
Sequence:CCGGCCGACAGGCAGGTCAAGATTTCTCGAGAAATCTTGACCTGCCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-407s1c1
Sequence:CCGGGTATTCTGATAAGCGCAACAACTCGAGTTGTTGCGCTTATCAGAATACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002148.2-373s1c1
Sequence:CCGGCCACCAACATTAAGGAAGAATCTCGAGATTCTTCCTTAATGTTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-312s1c1
Sequence:CCGGCCGAACAGATCTTGTCGAATACTCGAGTATTCGACAAGATCTGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002148.2-1265s1c1
Sequence:CCGGGCAAGTGATCTGTAATCCCTACTCGAGTAGGGATTACAGATCACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)