EMAIL THIS PAGE TO A FRIEND

HOXD12

homeobox D12

85 Gene Product Result for
Synonyms: HOX4H
UniProtKB ID: P35452, B5MCP0, Q9NS03
Gene ID:
Human(3238) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
Mouse(15432) homeobox D12
Rat(366082) homeo box D12
chicken(396178) homeobox D12
cow(520423) homeobox D12
dog(488413) homeobox D12
Goat(100860841) homeobox D12
sheep(101107071) homeobox D12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021193 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150701 MISSION® esiRNA esiRNA human HOXD12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021193 Rosetta Predictions human pricing
XM_001063522 Rosetta Predictions rat pricing
XM_345373 Rosetta Predictions rat pricing
NM_008274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113885 predicted 273
2 SASI_Hs01_00113886 predicted 275
3 SASI_Hs01_00113887 predicted 268
4 SASI_Hs01_00113888 predicted 328
5 SASI_Hs01_00113889 predicted 270
6 SASI_Hs01_00113890 predicted 207
7 SASI_Hs01_00113891 predicted 264
8 SASI_Hs01_00113892 predicted 305
9 SASI_Hs01_00113893 predicted 278
10 SASI_Hs01_00113894 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307412 predicted 429
2 SASI_Rn02_00307413 predicted 442
3 SASI_Rn02_00307414 predicted 616
4 SASI_Rn02_00307415 predicted 526
5 SASI_Rn02_00307416 predicted 335
6 SASI_Rn02_00307417 predicted 302
7 SASI_Rn02_00307418 predicted 358
8 SASI_Rn02_00307419 predicted 538
9 SASI_Rn02_00307420 predicted 541
10 SASI_Rn02_00307421 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398307 predicted 425
2 SASI_Rn02_00398308 predicted 435
3 SASI_Rn02_00398309 predicted 617
4 SASI_Rn02_00398310 predicted 520
5 SASI_Rn02_00398311 predicted 330
6 SASI_Rn02_00398312 predicted 305
7 SASI_Rn02_00398313 predicted 359
8 SASI_Rn02_00398314 predicted 547
9 SASI_Rn02_00398315 predicted 543
10 SASI_Rn02_00398316 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313511 predicted 705
2 SASI_Mm02_00313512 predicted 655
3 SASI_Mm01_00043643 predicted 334
4 SASI_Mm02_00313513 predicted 588
5 SASI_Mm02_00313514 predicted 821
6 SASI_Mm02_00313515 predicted 743
7 SASI_Mm02_00313516 predicted 543
8 SASI_Mm01_00043644 predicted 360
9 SASI_Mm02_00313517 predicted 675
10 SASI_Mm02_00313518 predicted 762
11 SASI_Mm01_00043641 predicted 376
12 SASI_Mm01_00043642 predicted 282
13 SASI_Mm01_00043645 predicted 243
14 SASI_Mm01_00043646 predicted 284
15 SASI_Mm01_00043647 predicted 290
16 SASI_Mm01_00043648 predicted 306
17 SASI_Mm01_00043649 predicted 314
18 SASI_Mm01_00043650 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008274
HOXD12 MISSION shRNA Bacterial Glycerol Stock
homeobox D12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008274.2-1272s21c1
Sequence:CCGGTAGCTAGAGCTCCGGGTATAACTCGAGTTATACCCGGAGCTCTAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008274.2-730s21c1
Sequence:CCGGATCAACCGGCAGAAGCGTAAGCTCGAGCTTACGCTTCTGCCGGTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008274.2-1079s21c1
Sequence:CCGGGTTTGGGAATTGCAATCTAACCTCGAGGTTAGATTGCAATTCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-649s1c1
Sequence:CCGGCCCTACACAAAGCAGCAGATTCTCGAGAATCTGCTGCTTTGTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-292s1c1
Sequence:CCGGGTCAAGTTCTATACGCCTGATCTCGAGATCAGGCGTATAGAACTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-372s1c1
Sequence:CCGGTCTGGTTCATTCGGCTCTCAACTCGAGTTGAGAGCCGAATGAACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-57s1c1
Sequence:CCGGGTCACCGGACTCTTTCTACTTCTCGAGAAGTAGAAAGAGTCCGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-501s1c1
Sequence:CCGGGCTCAACTTGAACATGGCAGTCTCGAGACTGCCATGTTCAAGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008274.2-842s21c1
Sequence:CCGGAGCAAGCACTGGCCCTCTATTCTCGAGAATAGAGGGCCAGTGCTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008274
HOXD12 MISSION shRNA shRNA Plasmid DNA
homeobox D12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008274.2-1272s21c1
Sequence:CCGGTAGCTAGAGCTCCGGGTATAACTCGAGTTATACCCGGAGCTCTAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008274.2-730s21c1
Sequence:CCGGATCAACCGGCAGAAGCGTAAGCTCGAGCTTACGCTTCTGCCGGTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008274.2-1079s21c1
Sequence:CCGGGTTTGGGAATTGCAATCTAACCTCGAGGTTAGATTGCAATTCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-649s1c1
Sequence:CCGGCCCTACACAAAGCAGCAGATTCTCGAGAATCTGCTGCTTTGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-292s1c1
Sequence:CCGGGTCAAGTTCTATACGCCTGATCTCGAGATCAGGCGTATAGAACTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-372s1c1
Sequence:CCGGTCTGGTTCATTCGGCTCTCAACTCGAGTTGAGAGCCGAATGAACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-57s1c1
Sequence:CCGGGTCACCGGACTCTTTCTACTTCTCGAGAAGTAGAAAGAGTCCGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-501s1c1
Sequence:CCGGGCTCAACTTGAACATGGCAGTCTCGAGACTGCCATGTTCAAGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008274.2-842s21c1
Sequence:CCGGAGCAAGCACTGGCCCTCTATTCTCGAGAATAGAGGGCCAGTGCTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008274
HOXD12 MISSION shRNA Lentiviral Transduction Particles
homeobox D12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008274.2-1272s21c1
Sequence:CCGGTAGCTAGAGCTCCGGGTATAACTCGAGTTATACCCGGAGCTCTAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008274.2-730s21c1
Sequence:CCGGATCAACCGGCAGAAGCGTAAGCTCGAGCTTACGCTTCTGCCGGTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008274.2-1079s21c1
Sequence:CCGGGTTTGGGAATTGCAATCTAACCTCGAGGTTAGATTGCAATTCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-649s1c1
Sequence:CCGGCCCTACACAAAGCAGCAGATTCTCGAGAATCTGCTGCTTTGTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-292s1c1
Sequence:CCGGGTCAAGTTCTATACGCCTGATCTCGAGATCAGGCGTATAGAACTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-372s1c1
Sequence:CCGGTCTGGTTCATTCGGCTCTCAACTCGAGTTGAGAGCCGAATGAACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-57s1c1
Sequence:CCGGGTCACCGGACTCTTTCTACTTCTCGAGAAGTAGAAAGAGTCCGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008274.1-501s1c1
Sequence:CCGGGCTCAACTTGAACATGGCAGTCTCGAGACTGCCATGTTCAAGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008274.2-842s21c1
Sequence:CCGGAGCAAGCACTGGCCCTCTATTCTCGAGAATAGAGGGCCAGTGCTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021193
HOXD12 MISSION shRNA Bacterial Glycerol Stock
homeobox D12
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-57s1c1
Sequence:CCGGGTCGCCAGACTCTTTCTACTTCTCGAGAAGTAGAAAGAGTCTGGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-505s1c1
Sequence:CCGGCCGCTCAACTTGAACATGACACTCGAGTGTCATGTTCAAGTTGAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-569s1c1
Sequence:CCGGCCGACGGTAAACGGTGCCCATCTCGAGATGGGCACCGTTTACCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-391s1c1
Sequence:CCGGGCTCTCAAAGCGGCCAAGTATCTCGAGATACTTGGCCGCTTTGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021193.3-542s21c1
Sequence:CCGGTTGCCTCTTGCCTGCGACCTTCTCGAGAAGGTCGCAGGCAAGAGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021193.3-281s21c1
Sequence:CCGGCCGAAGAGCAGGCTAAGTTCTCTCGAGAGAACTTAGCCTGCTCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021193
HOXD12 MISSION shRNA shRNA Plasmid DNA
homeobox D12
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-57s1c1
Sequence:CCGGGTCGCCAGACTCTTTCTACTTCTCGAGAAGTAGAAAGAGTCTGGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-505s1c1
Sequence:CCGGCCGCTCAACTTGAACATGACACTCGAGTGTCATGTTCAAGTTGAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-569s1c1
Sequence:CCGGCCGACGGTAAACGGTGCCCATCTCGAGATGGGCACCGTTTACCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-391s1c1
Sequence:CCGGGCTCTCAAAGCGGCCAAGTATCTCGAGATACTTGGCCGCTTTGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021193.3-542s21c1
Sequence:CCGGTTGCCTCTTGCCTGCGACCTTCTCGAGAAGGTCGCAGGCAAGAGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021193.3-281s21c1
Sequence:CCGGCCGAAGAGCAGGCTAAGTTCTCTCGAGAGAACTTAGCCTGCTCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021193
HOXD12 MISSION shRNA Lentiviral Transduction Particles
homeobox D12
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-57s1c1
Sequence:CCGGGTCGCCAGACTCTTTCTACTTCTCGAGAAGTAGAAAGAGTCTGGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-505s1c1
Sequence:CCGGCCGCTCAACTTGAACATGACACTCGAGTGTCATGTTCAAGTTGAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-569s1c1
Sequence:CCGGCCGACGGTAAACGGTGCCCATCTCGAGATGGGCACCGTTTACCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021193.2-391s1c1
Sequence:CCGGGCTCTCAAAGCGGCCAAGTATCTCGAGATACTTGGCCGCTTTGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021193.3-542s21c1
Sequence:CCGGTTGCCTCTTGCCTGCGACCTTCTCGAGAAGGTCGCAGGCAAGAGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021193.3-281s21c1
Sequence:CCGGCCGAAGAGCAGGCTAAGTTCTCTCGAGAGAACTTAGCCTGCTCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)