EMAIL THIS PAGE TO A FRIEND

HOXD13

homeobox D13

101 Gene Product Result for
Synonyms: BDE BDSD HOX4I SPD
UniProtKB ID: P35453
Gene ID:
Human(3239) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
Mouse(15433) homeobox D13
Rat(288154) homeo box D13
chicken(396415) homeobox D13
cow(520424) homeobox D13
Goat(100860842) homeobox D13
sheep(101104641) homeobox D13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000523 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000523 Rosetta Predictions human pricing
NM_001105886 Rosetta Predictions rat pricing
NM_008275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028225 predicted 962
2 SASI_Hs01_00028228 predicted 888
3 SASI_Hs02_00302717 predicted 916
4 SASI_Hs02_00302718 predicted 1017
5 SASI_Hs01_00028231 predicted 1142
6 SASI_Hs02_00302719 predicted 1547
7 SASI_Hs02_00302720 predicted 972
8 SASI_Hs02_00302721 predicted 1030
9 SASI_Hs02_00302722 predicted 1499
10 SASI_Hs02_00302723 predicted 1519
11 SASI_Hs01_00028226 predicted 1182
12 SASI_Hs01_00028227 predicted 1149
13 SASI_Hs01_00028229 predicted 800
14 SASI_Hs01_00028230 predicted 1024
15 SASI_Hs01_00028232 predicted 1062
16 SASI_Hs01_00028233 predicted 702
17 SASI_Hs01_00028234 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213502 predicted 867
2 SASI_Rn02_00213503 predicted 873
3 SASI_Rn02_00213504 predicted 921
4 SASI_Rn02_00213505 predicted 1447
5 SASI_Rn02_00213506 predicted 592
6 SASI_Rn02_00213507 predicted 541
7 SASI_Rn02_00213508 predicted 410
8 SASI_Rn02_00213509 predicted 1446
9 SASI_Rn02_00213510 predicted 95
10 SASI_Rn02_00213511 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032335 predicted 693
2 SASI_Mm02_00313519 predicted 864
3 SASI_Mm02_00313520 predicted 921
4 SASI_Mm01_00032337 predicted 538
5 SASI_Mm01_00032338 predicted 590
6 SASI_Mm01_00032339 predicted 518
7 SASI_Mm02_00313521 predicted 663
8 SASI_Mm02_00313522 predicted 830
9 SASI_Mm02_00313523 predicted 903
10 SASI_Mm02_00313524 predicted 919
11 SASI_Mm01_00032333 predicted 770
12 SASI_Mm01_00032334 predicted 469
13 SASI_Mm01_00032336 predicted 562
14 SASI_Mm01_00032340 predicted 758
15 SASI_Mm01_00032341 predicted 707
16 SASI_Mm01_00032342 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008275
HOXD13 MISSION shRNA Bacterial Glycerol Stock
homeobox D13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-859s1c1
Sequence:CCGGCTGGAGAATGAGTATGCCATTCTCGAGAATGGCATACTCATTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-453s1c1
Sequence:CCGGGCACGCTTCTCTCGGAGGTTTCTCGAGAAACCTCCGAGAGAAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-606s1c1
Sequence:CCGGCATCGACATGGTGTCCACTTTCTCGAGAAAGTGGACACCATGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-567s1c1
Sequence:CCGGCCAGGGCTACACAAGTCCCTACTCGAGTAGGGACTTGTGTAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-423s1c1
Sequence:CCGGCTTACAGCAGAACGCTCTCAACTCGAGTTGAGAGCGTTCTGCTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008275.2-1221s21c1
Sequence:CCGGATCCGACTTTGTAATTCTATTCTCGAGAATAGAATTACAAAGTCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008275.2-376s21c1
Sequence:CCGGCACTTCGGCAACGGTTACTACCTCGAGGTAGTAACCGTTGCCGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008275.2-1185s21c1
Sequence:CCGGTGACCTTTATCTGGTTCTAAACTCGAGTTTAGAACCAGATAAAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008275
HOXD13 MISSION shRNA shRNA Plasmid DNA
homeobox D13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-859s1c1
Sequence:CCGGCTGGAGAATGAGTATGCCATTCTCGAGAATGGCATACTCATTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-453s1c1
Sequence:CCGGGCACGCTTCTCTCGGAGGTTTCTCGAGAAACCTCCGAGAGAAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-606s1c1
Sequence:CCGGCATCGACATGGTGTCCACTTTCTCGAGAAAGTGGACACCATGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-567s1c1
Sequence:CCGGCCAGGGCTACACAAGTCCCTACTCGAGTAGGGACTTGTGTAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-423s1c1
Sequence:CCGGCTTACAGCAGAACGCTCTCAACTCGAGTTGAGAGCGTTCTGCTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008275.2-1221s21c1
Sequence:CCGGATCCGACTTTGTAATTCTATTCTCGAGAATAGAATTACAAAGTCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008275.2-376s21c1
Sequence:CCGGCACTTCGGCAACGGTTACTACCTCGAGGTAGTAACCGTTGCCGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008275.2-1185s21c1
Sequence:CCGGTGACCTTTATCTGGTTCTAAACTCGAGTTTAGAACCAGATAAAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008275
HOXD13 MISSION shRNA Lentiviral Transduction Particles
homeobox D13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-859s1c1
Sequence:CCGGCTGGAGAATGAGTATGCCATTCTCGAGAATGGCATACTCATTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-453s1c1
Sequence:CCGGGCACGCTTCTCTCGGAGGTTTCTCGAGAAACCTCCGAGAGAAGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-606s1c1
Sequence:CCGGCATCGACATGGTGTCCACTTTCTCGAGAAAGTGGACACCATGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-567s1c1
Sequence:CCGGCCAGGGCTACACAAGTCCCTACTCGAGTAGGGACTTGTGTAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008275.1-423s1c1
Sequence:CCGGCTTACAGCAGAACGCTCTCAACTCGAGTTGAGAGCGTTCTGCTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008275.2-1221s21c1
Sequence:CCGGATCCGACTTTGTAATTCTATTCTCGAGAATAGAATTACAAAGTCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008275.2-376s21c1
Sequence:CCGGCACTTCGGCAACGGTTACTACCTCGAGGTAGTAACCGTTGCCGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008275.2-1185s21c1
Sequence:CCGGTGACCTTTATCTGGTTCTAAACTCGAGTTTAGAACCAGATAAAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000523
VALIDATED
HOXD13 MISSION shRNA Bacterial Glycerol Stock
homeobox D13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-1066s1c1
Sequence:CCGGCGAAGAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-945s1c1
Sequence:CCGGGCAGCTTAAAGAACTGGAGAACTCGAGTTCTCCAGTTCTTTAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-486s1c1
Sequence:CCGGCGGCTACTACAGCTGCCGTATCTCGAGATACGGCAGCTGTAGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000523.2-666s1c1
Sequence:CCGGCCAGGGCTATACGAGCCCTTACTCGAGTAAGGGCTCGTATAGCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-352s21c1
Sequence:CCGGTCGTCCTCTTCTGCCGTTGTACTCGAGTACAACGGCAGAAGAGGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-1293s21c1
Sequence:CCGGCCTGACTTTGTAGTTCTGATTCTCGAGAATCAGAACTACAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-1066s21c1
Sequence:CCGGCGAAGAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-967s21c1
Sequence:CCGGGAGTATGCCATTAACAAATTCCTCGAGGAATTTGTTAATGGCATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-706s21c1
Sequence:CCGGATCGACATGGTGTCCACTTTCCTCGAGGAAAGTGGACACCATGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000523
VALIDATED
HOXD13 MISSION shRNA shRNA Plasmid DNA
homeobox D13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-1066s1c1
Sequence:CCGGCGAAGAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-945s1c1
Sequence:CCGGGCAGCTTAAAGAACTGGAGAACTCGAGTTCTCCAGTTCTTTAAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-486s1c1
Sequence:CCGGCGGCTACTACAGCTGCCGTATCTCGAGATACGGCAGCTGTAGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000523.2-666s1c1
Sequence:CCGGCCAGGGCTATACGAGCCCTTACTCGAGTAAGGGCTCGTATAGCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-352s21c1
Sequence:CCGGTCGTCCTCTTCTGCCGTTGTACTCGAGTACAACGGCAGAAGAGGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-1293s21c1
Sequence:CCGGCCTGACTTTGTAGTTCTGATTCTCGAGAATCAGAACTACAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-1066s21c1
Sequence:CCGGCGAAGAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-967s21c1
Sequence:CCGGGAGTATGCCATTAACAAATTCCTCGAGGAATTTGTTAATGGCATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-706s21c1
Sequence:CCGGATCGACATGGTGTCCACTTTCCTCGAGGAAAGTGGACACCATGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000523
VALIDATED
HOXD13 MISSION shRNA Lentiviral Transduction Particles
homeobox D13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-1066s1c1
Sequence:CCGGCGAAGAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-945s1c1
Sequence:CCGGGCAGCTTAAAGAACTGGAGAACTCGAGTTCTCCAGTTCTTTAAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000523.2-486s1c1
Sequence:CCGGCGGCTACTACAGCTGCCGTATCTCGAGATACGGCAGCTGTAGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000523.2-666s1c1
Sequence:CCGGCCAGGGCTATACGAGCCCTTACTCGAGTAAGGGCTCGTATAGCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-352s21c1
Sequence:CCGGTCGTCCTCTTCTGCCGTTGTACTCGAGTACAACGGCAGAAGAGGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-1293s21c1
Sequence:CCGGCCTGACTTTGTAGTTCTGATTCTCGAGAATCAGAACTACAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-1066s21c1
Sequence:CCGGCGAAGAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-967s21c1
Sequence:CCGGGAGTATGCCATTAACAAATTCCTCGAGGAATTTGTTAATGGCATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000523.3-706s21c1
Sequence:CCGGATCGACATGGTGTCCACTTTCCTCGAGGAAAGTGGACACCATGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)