EMAIL THIS PAGE TO A FRIEND

HOXD3

homeobox D3

121 Gene Product Result for
Synonyms: HOX1D HOX4 HOX4A Hox-4.1
UniProtKB ID: P31249, Q99955, Q9BSC5
Gene ID:
Human(3232) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in the regulation of cell adhesion processes. [provided by RefSeq, Jul 2008]
Mouse(15434) homeobox D3
Rat(288152) homeo box D3
chicken(431212) homeobox D3
dog(488417) homeobox D3
Horse(100053542) homeobox D3
cow(100295744) homeobox D3
sheep(101106307) homeobox D3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU174751 MISSION® esiRNA esiRNA targeting mouse Hoxd3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006898 Rosetta Predictions human pricing
XM_001064213 Rosetta Predictions rat pricing
XM_213633 Rosetta Predictions rat pricing
NM_010468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039181 predicted 1890
2 SASI_Hs01_00039183 predicted 1737
3 SASI_Hs02_00342574 predicted 289
4 SASI_Hs01_00039184 predicted 1884
5 SASI_Hs01_00039185 predicted 1743
6 SASI_Hs01_00039186 predicted 1687
7 SASI_Hs01_00039187 predicted 1843
8 SASI_Hs01_00039189 predicted 412
9 SASI_Hs01_00039190 predicted 1254
10 SASI_Hs02_00342575 predicted 1935
11 SASI_Hs01_00039182 predicted 255
12 SASI_Hs01_00039188 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309677 predicted 982
2 SASI_Rn02_00309678 predicted 860
3 SASI_Rn02_00309679 predicted 989
4 SASI_Rn02_00309680 predicted 983
5 SASI_Rn02_00309681 predicted 985
6 SASI_Rn02_00309682 predicted 1064
7 SASI_Rn02_00309683 predicted 1076
8 SASI_Rn02_00309684 predicted 602
9 SASI_Rn02_00309685 predicted 687
10 SASI_Rn02_00309686 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374776 predicted 627
2 SASI_Rn02_00374777 predicted 568
3 SASI_Rn02_00374778 predicted 599
4 SASI_Rn02_00374779 predicted 609
5 SASI_Rn02_00374780 predicted 628
6 SASI_Rn02_00374781 predicted 571
7 SASI_Rn02_00374782 predicted 646
8 SASI_Rn02_00374783 predicted 569
9 SASI_Rn02_00374784 predicted 629
10 SASI_Rn02_00374785 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318663 predicted 1041
2 SASI_Mm01_00082827 predicted 1981
3 SASI_Mm02_00318664 predicted 645
4 SASI_Mm02_00318665 predicted 1973
5 SASI_Mm02_00318666 predicted 1482
6 SASI_Mm02_00318667 predicted 1567
7 SASI_Mm02_00318668 predicted 652
8 SASI_Mm02_00318669 predicted 1315
9 SASI_Mm02_00318670 predicted 516
10 SASI_Mm02_00318671 predicted 504
11 SASI_Mm01_00082820 predicted 1405
12 SASI_Mm01_00082821 predicted 591
13 SASI_Mm01_00082822 predicted 1574
14 SASI_Mm01_00082823 predicted 610
15 SASI_Mm01_00082824 predicted 858
16 SASI_Mm01_00082825 predicted 1587
17 SASI_Mm01_00082826 predicted 1231
18 SASI_Mm01_00082828 predicted 853
19 SASI_Mm01_00082829 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006898
HOXD3 MISSION shRNA Bacterial Glycerol Stock
homeobox D3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006898.4-1887s21c1
Sequence:CCGGTAAGGATTGCATCGGACTAAACTCGAGTTTAGTCCGATGCAATCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006898.4-207s21c1
Sequence:CCGGGAGCTTCCTGAGTGCACAATGCTCGAGCATTGTGCACTCAGGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-252s1c1
Sequence:CCGGCCAGGACTGTTTGGAGGCTATCTCGAGATAGCCTCCAAACAGTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-677s1c1
Sequence:CCGGTCGACAGAACTCCAAGCAGAACTCGAGTTCTGCTTGGAGTTCTGTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-229s1c1
Sequence:CCGGAGAAGGCTGCTTACTATGAAACTCGAGTTTCATAGTAAGCAGCCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-1253s1c1
Sequence:CCGGCGGCAACTTCGTCGAGTCCATCTCGAGATGGACTCGACGAAGTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-1082s1c1
Sequence:CCGGCGCCAAATCACAGCCCAATATCTCGAGATATTGGGCTGTGATTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006898.4-1083s21c1
Sequence:CCGGGCCAAATCACAGCCCAATATGCTCGAGCATATTGGGCTGTGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006898.4-1660s21c1
Sequence:CCGGTTTGGGTGACTCGCCATAAATCTCGAGATTTATGGCGAGTCACCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006898
HOXD3 MISSION shRNA shRNA Plasmid DNA
homeobox D3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006898.4-1887s21c1
Sequence:CCGGTAAGGATTGCATCGGACTAAACTCGAGTTTAGTCCGATGCAATCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006898.4-207s21c1
Sequence:CCGGGAGCTTCCTGAGTGCACAATGCTCGAGCATTGTGCACTCAGGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-252s1c1
Sequence:CCGGCCAGGACTGTTTGGAGGCTATCTCGAGATAGCCTCCAAACAGTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-677s1c1
Sequence:CCGGTCGACAGAACTCCAAGCAGAACTCGAGTTCTGCTTGGAGTTCTGTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-229s1c1
Sequence:CCGGAGAAGGCTGCTTACTATGAAACTCGAGTTTCATAGTAAGCAGCCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-1253s1c1
Sequence:CCGGCGGCAACTTCGTCGAGTCCATCTCGAGATGGACTCGACGAAGTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-1082s1c1
Sequence:CCGGCGCCAAATCACAGCCCAATATCTCGAGATATTGGGCTGTGATTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006898.4-1083s21c1
Sequence:CCGGGCCAAATCACAGCCCAATATGCTCGAGCATATTGGGCTGTGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006898.4-1660s21c1
Sequence:CCGGTTTGGGTGACTCGCCATAAATCTCGAGATTTATGGCGAGTCACCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006898
HOXD3 MISSION shRNA Lentiviral Transduction Particles
homeobox D3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006898.4-1887s21c1
Sequence:CCGGTAAGGATTGCATCGGACTAAACTCGAGTTTAGTCCGATGCAATCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006898.4-207s21c1
Sequence:CCGGGAGCTTCCTGAGTGCACAATGCTCGAGCATTGTGCACTCAGGAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-252s1c1
Sequence:CCGGCCAGGACTGTTTGGAGGCTATCTCGAGATAGCCTCCAAACAGTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-677s1c1
Sequence:CCGGTCGACAGAACTCCAAGCAGAACTCGAGTTCTGCTTGGAGTTCTGTCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-229s1c1
Sequence:CCGGAGAAGGCTGCTTACTATGAAACTCGAGTTTCATAGTAAGCAGCCTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-1253s1c1
Sequence:CCGGCGGCAACTTCGTCGAGTCCATCTCGAGATGGACTCGACGAAGTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006898.4-1082s1c1
Sequence:CCGGCGCCAAATCACAGCCCAATATCTCGAGATATTGGGCTGTGATTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006898.4-1083s21c1
Sequence:CCGGGCCAAATCACAGCCCAATATGCTCGAGCATATTGGGCTGTGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006898.4-1660s21c1
Sequence:CCGGTTTGGGTGACTCGCCATAAATCTCGAGATTTATGGCGAGTCACCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010468
HOXD3 MISSION shRNA Bacterial Glycerol Stock
homeobox D3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-819s1c1
Sequence:CCGGCCGTCGCATGAAGTACAAGAACTCGAGTTCTTGTACTTCATGCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-473s1c1
Sequence:CCGGCTTCACCTACCAATCCTGGAACTCGAGTTCCAGGATTGGTAGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-335s1c1
Sequence:CCGGCTGAACTCAATGGTAGCTGTACTCGAGTACAGCTACCATTGAGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-260s1c1
Sequence:CCGGTGGACAGTGATTACCCAAGTTCTCGAGAACTTGGGTAATCACTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-176s1c1
Sequence:CCGGGCTACGGATATAGCAAAGCCACTCGAGTGGCTTTGCTATATCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010468
HOXD3 MISSION shRNA shRNA Plasmid DNA
homeobox D3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-819s1c1
Sequence:CCGGCCGTCGCATGAAGTACAAGAACTCGAGTTCTTGTACTTCATGCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-473s1c1
Sequence:CCGGCTTCACCTACCAATCCTGGAACTCGAGTTCCAGGATTGGTAGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-335s1c1
Sequence:CCGGCTGAACTCAATGGTAGCTGTACTCGAGTACAGCTACCATTGAGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-260s1c1
Sequence:CCGGTGGACAGTGATTACCCAAGTTCTCGAGAACTTGGGTAATCACTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-176s1c1
Sequence:CCGGGCTACGGATATAGCAAAGCCACTCGAGTGGCTTTGCTATATCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010468
HOXD3 MISSION shRNA Lentiviral Transduction Particles
homeobox D3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-819s1c1
Sequence:CCGGCCGTCGCATGAAGTACAAGAACTCGAGTTCTTGTACTTCATGCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-473s1c1
Sequence:CCGGCTTCACCTACCAATCCTGGAACTCGAGTTCCAGGATTGGTAGGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-335s1c1
Sequence:CCGGCTGAACTCAATGGTAGCTGTACTCGAGTACAGCTACCATTGAGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-260s1c1
Sequence:CCGGTGGACAGTGATTACCCAAGTTCTCGAGAACTTGGGTAATCACTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010468.1-176s1c1
Sequence:CCGGGCTACGGATATAGCAAAGCCACTCGAGTGGCTTTGCTATATCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)