EMAIL THIS PAGE TO A FRIEND

HOXD4

homeobox D4

80 Gene Product Result for
Synonyms: HHO.C13 HOX-5.1 HOX4 HOX4B Hox-4.2
UniProtKB ID: P09016, B2R9R3, Q96AU0
Gene ID:
Human(3233) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in determining positional values in developing limb buds. Alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(15436) homeobox D4
Rat(288153) homeo box D4
sheep(101106568) homeobox D4
chicken(424139) homeobox D4
cow(513306) homeobox D4
dog(609989) homeobox D4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139091 MISSION® esiRNA esiRNA human HOXD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014621 Rosetta Predictions human pricing
NM_001105885 Rosetta Predictions rat pricing
NM_010469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080475 predicted 998
2 SASI_Hs01_00080476 predicted 261
3 SASI_Hs01_00080477 predicted 877
4 SASI_Hs01_00080478 predicted 795
5 SASI_Hs01_00080480 predicted 257
6 SASI_Hs01_00080481 predicted 813
7 SASI_Hs01_00080482 predicted 776
8 SASI_Hs01_00080483 predicted 991
9 SASI_Hs01_00080484 predicted 245
10 SASI_Hs02_00345917 predicted 979
11 SASI_Hs01_00080479 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213492 predicted 2404
2 SASI_Rn02_00213493 predicted 2343
3 SASI_Rn02_00213494 predicted 2394
4 SASI_Rn02_00213495 predicted 2142
5 SASI_Rn02_00213496 predicted 1408
6 SASI_Rn02_00213497 predicted 2373
7 SASI_Rn02_00213498 predicted 2179
8 SASI_Rn02_00213499 predicted 1792
9 SASI_Rn02_00213500 predicted 1935
10 SASI_Rn02_00213501 predicted 2476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077719 predicted 2215
2 SASI_Mm01_00077725 predicted 1966
3 SASI_Mm01_00077720 predicted 2259
4 SASI_Mm01_00077721 predicted 1236
5 SASI_Mm01_00077722 predicted 2180
6 SASI_Mm01_00077724 predicted 2182
7 SASI_Mm01_00077726 predicted 2214
8 SASI_Mm02_00318672 predicted 1613
9 SASI_Mm02_00318673 predicted 1754
10 SASI_Mm02_00318674 predicted 2002
11 SASI_Mm01_00077718 predicted 1717
12 SASI_Mm01_00077723 predicted 2248
13 SASI_Mm01_00077727 predicted 2006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010469
HOXD4 MISSION shRNA Bacterial Glycerol Stock
homeobox D4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1619s1c1
Sequence:CCGGCGCTGTGGTCTACCCTTGGATCTCGAGATCCAAGGGTAGACCACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1888s1c1
Sequence:CCGGGCAGGTCTTCTTCCTCATCTTCTCGAGAAGATGAGGAAGAAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1293s1c1
Sequence:CCGGTGCGAGGAATATTTGCAGGGTCTCGAGACCCTGCAAATATTCCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1965s1c1
Sequence:CCGGCATACGGACCTGACGACCTTACTCGAGTAAGGTCGTCAGGTCCGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1720s1c1
Sequence:CCGGAGCAAGTCCTAGAACTGGAAACTCGAGTTTCCAGTTCTAGGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010469.2-2235s21c1
Sequence:CCGGTAAACCCTTGGCGAGTCATTACTCGAGTAATGACTCGCCAAGGGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010469.2-1937s21c1
Sequence:CCGGCATTTGCAGCCAATGGCCAAGCTCGAGCTTGGCCATTGGCTGCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010469
HOXD4 MISSION shRNA shRNA Plasmid DNA
homeobox D4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1619s1c1
Sequence:CCGGCGCTGTGGTCTACCCTTGGATCTCGAGATCCAAGGGTAGACCACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1888s1c1
Sequence:CCGGGCAGGTCTTCTTCCTCATCTTCTCGAGAAGATGAGGAAGAAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1293s1c1
Sequence:CCGGTGCGAGGAATATTTGCAGGGTCTCGAGACCCTGCAAATATTCCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1965s1c1
Sequence:CCGGCATACGGACCTGACGACCTTACTCGAGTAAGGTCGTCAGGTCCGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1720s1c1
Sequence:CCGGAGCAAGTCCTAGAACTGGAAACTCGAGTTTCCAGTTCTAGGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010469.2-2235s21c1
Sequence:CCGGTAAACCCTTGGCGAGTCATTACTCGAGTAATGACTCGCCAAGGGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010469.2-1937s21c1
Sequence:CCGGCATTTGCAGCCAATGGCCAAGCTCGAGCTTGGCCATTGGCTGCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010469
HOXD4 MISSION shRNA Lentiviral Transduction Particles
homeobox D4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1619s1c1
Sequence:CCGGCGCTGTGGTCTACCCTTGGATCTCGAGATCCAAGGGTAGACCACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1888s1c1
Sequence:CCGGGCAGGTCTTCTTCCTCATCTTCTCGAGAAGATGAGGAAGAAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1293s1c1
Sequence:CCGGTGCGAGGAATATTTGCAGGGTCTCGAGACCCTGCAAATATTCCTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1965s1c1
Sequence:CCGGCATACGGACCTGACGACCTTACTCGAGTAAGGTCGTCAGGTCCGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010469.1-1720s1c1
Sequence:CCGGAGCAAGTCCTAGAACTGGAAACTCGAGTTTCCAGTTCTAGGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010469.2-2235s21c1
Sequence:CCGGTAAACCCTTGGCGAGTCATTACTCGAGTAATGACTCGCCAAGGGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010469.2-1937s21c1
Sequence:CCGGCATTTGCAGCCAATGGCCAAGCTCGAGCTTGGCCATTGGCTGCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014621
HOXD4 MISSION shRNA Bacterial Glycerol Stock
homeobox D4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-996s1c1
Sequence:CCGGCACGGACCTGACGACCTTATACTCGAGTATAAGGTCGTCAGGTCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-896s1c1
Sequence:CCGGCCAACACTAAAGGCAGGTCATCTCGAGATGACCTGCCTTTAGTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-797s1c1
Sequence:CCGGGTCGGATTGAAATCGCTCACACTCGAGTGTGAGCGATTTCAATCCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-658s21c1
Sequence:CCGGATGAAGAAGGTGCACGTGAATCTCGAGATTCACGTGCACCTTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-798s21c1
Sequence:CCGGTCGGATTGAAATCGCTCACACCTCGAGGTGTGAGCGATTTCAATCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-886s21c1
Sequence:CCGGCATAAGCTGCCCAACACTAAACTCGAGTTTAGTGTTGGGCAGCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-301s21c1
Sequence:CCGGCCTCCGTGCGAGGAGTATTTGCTCGAGCAAATACTCCTCGCACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-997s21c1
Sequence:CCGGACGGACCTGACGACCTTATAGCTCGAGCTATAAGGTCGTCAGGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014621
HOXD4 MISSION shRNA shRNA Plasmid DNA
homeobox D4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-996s1c1
Sequence:CCGGCACGGACCTGACGACCTTATACTCGAGTATAAGGTCGTCAGGTCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-896s1c1
Sequence:CCGGCCAACACTAAAGGCAGGTCATCTCGAGATGACCTGCCTTTAGTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-797s1c1
Sequence:CCGGGTCGGATTGAAATCGCTCACACTCGAGTGTGAGCGATTTCAATCCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-658s21c1
Sequence:CCGGATGAAGAAGGTGCACGTGAATCTCGAGATTCACGTGCACCTTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-798s21c1
Sequence:CCGGTCGGATTGAAATCGCTCACACCTCGAGGTGTGAGCGATTTCAATCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-886s21c1
Sequence:CCGGCATAAGCTGCCCAACACTAAACTCGAGTTTAGTGTTGGGCAGCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-301s21c1
Sequence:CCGGCCTCCGTGCGAGGAGTATTTGCTCGAGCAAATACTCCTCGCACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-997s21c1
Sequence:CCGGACGGACCTGACGACCTTATAGCTCGAGCTATAAGGTCGTCAGGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014621
HOXD4 MISSION shRNA Lentiviral Transduction Particles
homeobox D4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-996s1c1
Sequence:CCGGCACGGACCTGACGACCTTATACTCGAGTATAAGGTCGTCAGGTCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-896s1c1
Sequence:CCGGCCAACACTAAAGGCAGGTCATCTCGAGATGACCTGCCTTTAGTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014621.2-797s1c1
Sequence:CCGGGTCGGATTGAAATCGCTCACACTCGAGTGTGAGCGATTTCAATCCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-658s21c1
Sequence:CCGGATGAAGAAGGTGCACGTGAATCTCGAGATTCACGTGCACCTTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-798s21c1
Sequence:CCGGTCGGATTGAAATCGCTCACACCTCGAGGTGTGAGCGATTTCAATCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-886s21c1
Sequence:CCGGCATAAGCTGCCCAACACTAAACTCGAGTTTAGTGTTGGGCAGCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-301s21c1
Sequence:CCGGCCTCCGTGCGAGGAGTATTTGCTCGAGCAAATACTCCTCGCACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014621.2-997s21c1
Sequence:CCGGACGGACCTGACGACCTTATAGCTCGAGCTATAAGGTCGTCAGGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)