EMAIL THIS PAGE TO A FRIEND

HOXD8

homeobox D8

99 Gene Product Result for
Synonyms: HOX4 HOX4E HOX5.4
UniProtKB ID: P13378, F8WBG7, Q5BL00, Q8IXZ1
Gene ID:
Human(3234) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. In addition to effects during embryogenesis, this particular gene may also play a role in adult urogenital tract function. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
Mouse(15437) homeobox D8
Rat(100912020) homeobox D8
chicken(396301) homeobox D8
cow(100295814) homeobox D8
dog(100687992) homeobox D8
sheep(101103879) homeobox D8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019558 Rosetta Predictions human pricing
NM_008276 Rosetta Predictions mouse pricing
XM_355338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232974 predicted 1541
2 SASI_Hs01_00232975 predicted 1294
3 SASI_Hs02_00352766 predicted 1396
4 SASI_Hs01_00232976 predicted 1476
5 SASI_Hs01_00232977 predicted 1226
6 SASI_Hs01_00232978 predicted 1398
7 SASI_Hs01_00232979 predicted 1221
8 SASI_Hs01_00232980 predicted 1469
9 SASI_Hs02_00352767 predicted 1463
10 SASI_Hs01_00232981 predicted 1572
11 SASI_Hs01_00232982 predicted 1588
12 SASI_Hs01_00232983 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313525 predicted 947
2 SASI_Mm02_00313526 predicted 962
3 SASI_Mm02_00313527 predicted 517
4 SASI_Mm02_00313528 predicted 950
5 SASI_Mm02_00313529 predicted 1173
6 SASI_Mm02_00313530 predicted 501
7 SASI_Mm02_00313531 predicted 1037
8 SASI_Mm02_00313532 predicted 1060
9 SASI_Mm02_00313533 predicted 1160
10 SASI_Mm02_00313534 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208243 predicted 1029
2 SASI_Mm01_00208244 predicted 911
3 SASI_Mm01_00208245 predicted 896
4 SASI_Mm01_00208246 predicted 416
5 SASI_Mm01_00208247 predicted 1103
6 SASI_Mm01_00208248 predicted 669
7 SASI_Mm01_00208249 predicted 894
8 SASI_Mm01_00208250 predicted 913
9 SASI_Mm01_00208251 predicted 494
10 SASI_Mm01_00208252 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008276
VALIDATED
HOXD8 MISSION shRNA Bacterial Glycerol Stock
homeobox D8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-509s21c1
Sequence:CCGGAGAGGCCGAGCTGGTACAATACTCGAGTATTGTACCAGCTCGGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-1176s21c1
Sequence:CCGGTACGGACCTTGTGGCTATATTCTCGAGAATATAGCCACAAGGTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-563s21c1
Sequence:CCGGCGAGGACCCAGACCACTTAAACTCGAGTTTAAGTGGTCTGGGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-475s21c1
Sequence:CCGGACTTACAGAGACAGCCGATTTCTCGAGAAATCGGCTGTCTCTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-539s21c1
Sequence:CCGGTAAATCGTCCAGTGGTAATATCTCGAGATATTACCACTGGACGATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008276
VALIDATED
HOXD8 MISSION shRNA shRNA Plasmid DNA
homeobox D8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-509s21c1
Sequence:CCGGAGAGGCCGAGCTGGTACAATACTCGAGTATTGTACCAGCTCGGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-1176s21c1
Sequence:CCGGTACGGACCTTGTGGCTATATTCTCGAGAATATAGCCACAAGGTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-563s21c1
Sequence:CCGGCGAGGACCCAGACCACTTAAACTCGAGTTTAAGTGGTCTGGGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-475s21c1
Sequence:CCGGACTTACAGAGACAGCCGATTTCTCGAGAAATCGGCTGTCTCTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-539s21c1
Sequence:CCGGTAAATCGTCCAGTGGTAATATCTCGAGATATTACCACTGGACGATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008276
VALIDATED
HOXD8 MISSION shRNA Lentiviral Transduction Particles
homeobox D8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-509s21c1
Sequence:CCGGAGAGGCCGAGCTGGTACAATACTCGAGTATTGTACCAGCTCGGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-1176s21c1
Sequence:CCGGTACGGACCTTGTGGCTATATTCTCGAGAATATAGCCACAAGGTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-563s21c1
Sequence:CCGGCGAGGACCCAGACCACTTAAACTCGAGTTTAAGTGGTCTGGGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-475s21c1
Sequence:CCGGACTTACAGAGACAGCCGATTTCTCGAGAAATCGGCTGTCTCTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008276.2-539s21c1
Sequence:CCGGTAAATCGTCCAGTGGTAATATCTCGAGATATTACCACTGGACGATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019558
VALIDATED
HOXD8 MISSION shRNA Bacterial Glycerol Stock
homeobox D8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019558.2-1694s21c1
Sequence:CCGGTGTCCTATGGAAGGGTAATTTCTCGAGAAATTACCCTTCCATAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1470s21c1
Sequence:CCGGAGCCGAAGGCCTGACAAATTACTCGAGTAATTTGTCAGGCCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1128s21c1
Sequence:CCGGCGAGGACCCAGACCACTTAAACTCGAGTTTAAGTGGTCTGGGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1104s21c1
Sequence:CCGGTAAATCGTCCAGTGGTAATATCTCGAGATATTACCACTGGACGATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1074s21c1
Sequence:CCGGAGAGGCCGAGCTGGTACAATACTCGAGTATTGTACCAGCTCGGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_019558.2-1692s1c1
Sequence:CCGGGCTGTCCTATGGAAGGGTAATCTCGAGATTACCCTTCCATAGGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-690s1c1
Sequence:CCGGCGAGGCCATCAATCCCACTTACTCGAGTAAGTGGGATTGATGGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-1040s1c1
Sequence:CCGGACTTACAGAGACAGCCGATTTCTCGAGAAATCGGCTGTCTCTGTAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_019558.2-1096s1c1
Sequence:CCGGCCTGACTGTAAATCGTCCAGTCTCGAGACTGGACGATTTACAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-1238s1c1
Sequence:CCGGTCCAAACTCTAGAGTTGGAAACTCGAGTTTCCAACTCTAGAGTTTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019558
VALIDATED
HOXD8 MISSION shRNA shRNA Plasmid DNA
homeobox D8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019558.2-1694s21c1
Sequence:CCGGTGTCCTATGGAAGGGTAATTTCTCGAGAAATTACCCTTCCATAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1470s21c1
Sequence:CCGGAGCCGAAGGCCTGACAAATTACTCGAGTAATTTGTCAGGCCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1128s21c1
Sequence:CCGGCGAGGACCCAGACCACTTAAACTCGAGTTTAAGTGGTCTGGGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1104s21c1
Sequence:CCGGTAAATCGTCCAGTGGTAATATCTCGAGATATTACCACTGGACGATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1074s21c1
Sequence:CCGGAGAGGCCGAGCTGGTACAATACTCGAGTATTGTACCAGCTCGGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_019558.2-1692s1c1
Sequence:CCGGGCTGTCCTATGGAAGGGTAATCTCGAGATTACCCTTCCATAGGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-690s1c1
Sequence:CCGGCGAGGCCATCAATCCCACTTACTCGAGTAAGTGGGATTGATGGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-1040s1c1
Sequence:CCGGACTTACAGAGACAGCCGATTTCTCGAGAAATCGGCTGTCTCTGTAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_019558.2-1096s1c1
Sequence:CCGGCCTGACTGTAAATCGTCCAGTCTCGAGACTGGACGATTTACAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-1238s1c1
Sequence:CCGGTCCAAACTCTAGAGTTGGAAACTCGAGTTTCCAACTCTAGAGTTTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019558
VALIDATED
HOXD8 MISSION shRNA Lentiviral Transduction Particles
homeobox D8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019558.2-1694s21c1
Sequence:CCGGTGTCCTATGGAAGGGTAATTTCTCGAGAAATTACCCTTCCATAGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1470s21c1
Sequence:CCGGAGCCGAAGGCCTGACAAATTACTCGAGTAATTTGTCAGGCCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1128s21c1
Sequence:CCGGCGAGGACCCAGACCACTTAAACTCGAGTTTAAGTGGTCTGGGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1104s21c1
Sequence:CCGGTAAATCGTCCAGTGGTAATATCTCGAGATATTACCACTGGACGATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019558.2-1074s21c1
Sequence:CCGGAGAGGCCGAGCTGGTACAATACTCGAGTATTGTACCAGCTCGGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_019558.2-1692s1c1
Sequence:CCGGGCTGTCCTATGGAAGGGTAATCTCGAGATTACCCTTCCATAGGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-690s1c1
Sequence:CCGGCGAGGCCATCAATCCCACTTACTCGAGTAAGTGGGATTGATGGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-1040s1c1
Sequence:CCGGACTTACAGAGACAGCCGATTTCTCGAGAAATCGGCTGTCTCTGTAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_019558.2-1096s1c1
Sequence:CCGGCCTGACTGTAAATCGTCCAGTCTCGAGACTGGACGATTTACAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019558.2-1238s1c1
Sequence:CCGGTCCAAACTCTAGAGTTGGAAACTCGAGTTTCCAACTCTAGAGTTTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)