EMAIL THIS PAGE TO A FRIEND

HOXD9

homeobox D9

54 Gene Product Result for
Synonyms: HOX4 HOX4C Hox-4.3 Hox-5.2
UniProtKB ID: P28356, Q86ST1
Gene ID:
Human(3235) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
Mouse(15438) homeobox D9
Rat(688999) homeo box D9
sheep(101104131) homeobox D9
chicken(771214) homeobox D9
cow(100295338) homeobox D9
dog(609984) homeobox D9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138661 MISSION® esiRNA esiRNA human HOXD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014213 Rosetta Predictions human pricing
XM_001069122 Rosetta Predictions rat pricing
NM_013555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243090 predicted 591
2 SASI_Hs01_00243091 predicted 1310
3 SASI_Hs01_00243092 predicted 590
4 SASI_Hs01_00243093 predicted 460
5 SASI_Hs01_00243094 predicted 582
6 SASI_Hs01_00243095 predicted 1294
7 SASI_Hs01_00243096 predicted 1208
8 SASI_Hs01_00243097 predicted 1301
9 SASI_Hs01_00243098 predicted 681
10 SASI_Hs01_00243099 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326988 predicted 1224
2 SASI_Rn02_00326989 predicted 1224
3 SASI_Rn02_00326990 predicted 1160
4 SASI_Rn02_00326991 predicted 1831
5 SASI_Rn02_00326992 predicted 1268
6 SASI_Rn02_00326993 predicted 1703
7 SASI_Rn02_00326994 predicted 1154
8 SASI_Rn02_00326995 predicted 1401
9 SASI_Rn02_00326996 predicted 1909
10 SASI_Rn02_00326997 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135603 predicted 1627
2 SASI_Mm01_00135604 predicted 1730
3 SASI_Mm01_00135605 predicted 1740
4 SASI_Mm01_00135606 predicted 1067
5 SASI_Mm01_00135607 predicted 1728
6 SASI_Mm01_00135608 predicted 1684
7 SASI_Mm01_00135609 predicted 1646
8 SASI_Mm01_00135610 predicted 1705
9 SASI_Mm01_00135611 predicted 1641
10 SASI_Mm01_00135612 predicted 1701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014213
VALIDATED
HOXD9 MISSION shRNA Bacterial Glycerol Stock
homeobox D9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-1024s1c1
Sequence:CCGGCGAGTTCTCGTGCAACTCGTTCTCGAGAACGAGTTGCACGAGAACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-1210s1c1
Sequence:CCGGGCAGCAACTTGACCCAAACAACTCGAGTTGTTTGGGTCAAGTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-879s1c1
Sequence:CCGGACTACGGGATTAAGCCTGAAACTCGAGTTTCAGGCTTAATCCCGTAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014213.2-588s1c1
Sequence:CCGGCCGCCGAGTTCGCCTCGTGTACTCGAGTACACGAGGCGAACTCGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014213.2-1725s1c1
Sequence:CCGGCCTGCTCCATTGGTTCCTTAACTCGAGTTAAGGAACCAATGGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1323s21c1
Sequence:CCGGGACTCTGTATTTGCTCGTTTACTCGAGTAAACGAGCAAATACAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1209s21c1
Sequence:CCGGTGGGTGTTTGGTGCTTGATTTCTCGAGAAATCAAGCACCAAACACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1566s21c1
Sequence:CCGGATGAAGGCAGAGCGACAACAGCTCGAGCTGTTGTCGCTCTGCCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014213
VALIDATED
HOXD9 MISSION shRNA shRNA Plasmid DNA
homeobox D9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-1024s1c1
Sequence:CCGGCGAGTTCTCGTGCAACTCGTTCTCGAGAACGAGTTGCACGAGAACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-1210s1c1
Sequence:CCGGGCAGCAACTTGACCCAAACAACTCGAGTTGTTTGGGTCAAGTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-879s1c1
Sequence:CCGGACTACGGGATTAAGCCTGAAACTCGAGTTTCAGGCTTAATCCCGTAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014213.2-588s1c1
Sequence:CCGGCCGCCGAGTTCGCCTCGTGTACTCGAGTACACGAGGCGAACTCGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014213.2-1725s1c1
Sequence:CCGGCCTGCTCCATTGGTTCCTTAACTCGAGTTAAGGAACCAATGGAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1323s21c1
Sequence:CCGGGACTCTGTATTTGCTCGTTTACTCGAGTAAACGAGCAAATACAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1209s21c1
Sequence:CCGGTGGGTGTTTGGTGCTTGATTTCTCGAGAAATCAAGCACCAAACACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1566s21c1
Sequence:CCGGATGAAGGCAGAGCGACAACAGCTCGAGCTGTTGTCGCTCTGCCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014213
VALIDATED
HOXD9 MISSION shRNA Lentiviral Transduction Particles
homeobox D9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-1024s1c1
Sequence:CCGGCGAGTTCTCGTGCAACTCGTTCTCGAGAACGAGTTGCACGAGAACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-1210s1c1
Sequence:CCGGGCAGCAACTTGACCCAAACAACTCGAGTTGTTTGGGTCAAGTTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014213.2-879s1c1
Sequence:CCGGACTACGGGATTAAGCCTGAAACTCGAGTTTCAGGCTTAATCCCGTAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014213.2-588s1c1
Sequence:CCGGCCGCCGAGTTCGCCTCGTGTACTCGAGTACACGAGGCGAACTCGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014213.2-1725s1c1
Sequence:CCGGCCTGCTCCATTGGTTCCTTAACTCGAGTTAAGGAACCAATGGAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1323s21c1
Sequence:CCGGGACTCTGTATTTGCTCGTTTACTCGAGTAAACGAGCAAATACAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1209s21c1
Sequence:CCGGTGGGTGTTTGGTGCTTGATTTCTCGAGAAATCAAGCACCAAACACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014213.3-1566s21c1
Sequence:CCGGATGAAGGCAGAGCGACAACAGCTCGAGCTGTTGTCGCTCTGCCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013555
VALIDATED
HOXD9 MISSION shRNA Bacterial Glycerol Stock
homeobox D9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-1244s1c1
Sequence:CCGGGCCAGGATTCTGAACCTTACACTCGAGTGTAAGGTTCAGAATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-481s1c1
Sequence:CCGGCGAGTTCGCCTCGTGTAGTTTCTCGAGAAACTACACGAGGCGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-919s1c1
Sequence:CCGGCAACTCGTTCCTGCGGGACAACTCGAGTTGTCCCGCAGGAACGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-362s1c1
Sequence:CCGGGTGGACTCGCTCATAGGCCATCTCGAGATGGCCTATGAGCGAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-903s1c1
Sequence:CCGGGCCCAGAATTCCCGTGCAACTCTCGAGAGTTGCACGGGAATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013555.3-1603s21c1
Sequence:CCGGTCCTTAGGAAATGCTATATTTCTCGAGAAATATAGCATTTCCTAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013555.3-1209s21c1
Sequence:CCGGGCCAGGATTCTGAACCTTACACTCGAGTGTAAGGTTCAGAATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013555.3-884s21c1
Sequence:CCGGCAACTCGTTCCTGCGGGACAACTCGAGTTGTCCCGCAGGAACGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013555.3-1285s21c1
Sequence:CCGGGCAAGGAGAAGTGCCCTAAAGCTCGAGCTTTAGGGCACTTCTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013555
VALIDATED
HOXD9 MISSION shRNA shRNA Plasmid DNA
homeobox D9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-1244s1c1
Sequence:CCGGGCCAGGATTCTGAACCTTACACTCGAGTGTAAGGTTCAGAATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-481s1c1
Sequence:CCGGCGAGTTCGCCTCGTGTAGTTTCTCGAGAAACTACACGAGGCGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-919s1c1
Sequence:CCGGCAACTCGTTCCTGCGGGACAACTCGAGTTGTCCCGCAGGAACGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-362s1c1
Sequence:CCGGGTGGACTCGCTCATAGGCCATCTCGAGATGGCCTATGAGCGAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-903s1c1
Sequence:CCGGGCCCAGAATTCCCGTGCAACTCTCGAGAGTTGCACGGGAATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013555.3-1603s21c1
Sequence:CCGGTCCTTAGGAAATGCTATATTTCTCGAGAAATATAGCATTTCCTAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013555.3-1209s21c1
Sequence:CCGGGCCAGGATTCTGAACCTTACACTCGAGTGTAAGGTTCAGAATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013555.3-884s21c1
Sequence:CCGGCAACTCGTTCCTGCGGGACAACTCGAGTTGTCCCGCAGGAACGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013555.3-1285s21c1
Sequence:CCGGGCAAGGAGAAGTGCCCTAAAGCTCGAGCTTTAGGGCACTTCTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013555
VALIDATED
HOXD9 MISSION shRNA Lentiviral Transduction Particles
homeobox D9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-1244s1c1
Sequence:CCGGGCCAGGATTCTGAACCTTACACTCGAGTGTAAGGTTCAGAATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-481s1c1
Sequence:CCGGCGAGTTCGCCTCGTGTAGTTTCTCGAGAAACTACACGAGGCGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-919s1c1
Sequence:CCGGCAACTCGTTCCTGCGGGACAACTCGAGTTGTCCCGCAGGAACGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-362s1c1
Sequence:CCGGGTGGACTCGCTCATAGGCCATCTCGAGATGGCCTATGAGCGAGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013555.2-903s1c1
Sequence:CCGGGCCCAGAATTCCCGTGCAACTCTCGAGAGTTGCACGGGAATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013555.3-1603s21c1
Sequence:CCGGTCCTTAGGAAATGCTATATTTCTCGAGAAATATAGCATTTCCTAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013555.3-1209s21c1
Sequence:CCGGGCCAGGATTCTGAACCTTACACTCGAGTGTAAGGTTCAGAATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013555.3-884s21c1
Sequence:CCGGCAACTCGTTCCTGCGGGACAACTCGAGTTGTCCCGCAGGAACGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013555.3-1285s21c1
Sequence:CCGGGCAAGGAGAAGTGCCCTAAAGCTCGAGCTTTAGGGCACTTCTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)