EMAIL THIS PAGE TO A FRIEND

HP1BP3

heterochromatin protein 1, binding protein 3

186 Gene Product Result for
Synonyms: HP1-BP74
Gene ID:
Mouse(15441) heterochromatin protein 1, binding protein 3
Rat(313647) heterochromatin protein 1, binding protein 3
sheep(101105636) heterochromatin protein 1, binding protein 3
Domestic Rabbit(100350178) heterochromatin protein 1, binding protein 3
domestic guinea pig(100726481) heterochromatin protein 1, binding protein 3
naked mole-rat(101718801) heterochromatin protein 1, binding protein 3
Zebrafish(558102) heterochromatin protein 1, binding protein 3
cow(510194) heterochromatin protein 1, binding protein 3
Horse(100058320) heterochromatin protein 1, binding protein 3
chicken(425543) heterochromatin protein 1, binding protein 3
dog(478203) heterochromatin protein 1, binding protein 3
domestic cat(101093532) heterochromatin protein 1, binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065871 MISSION® esiRNA esiRNA human HP1BP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016287 Rosetta Predictions human pricing
NM_199108 Rosetta Predictions rat pricing
NM_001122896 Rosetta Predictions mouse pricing
NM_001122897 Rosetta Predictions mouse pricing
NM_010470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068990 predicted 1397
2 SASI_Hs01_00068991 predicted 1494
3 SASI_Hs02_00349207 predicted 1763
4 SASI_Hs01_00068992 predicted 776
5 SASI_Hs01_00068993 predicted 1260
6 SASI_Hs02_00349208 predicted 1404
7 SASI_Hs01_00068996 predicted 1489
8 SASI_Hs01_00068997 predicted 1257
9 SASI_Hs02_00349209 predicted 765
10 SASI_Hs02_00349210 predicted 1243
11 SASI_Hs01_00068989 predicted 600
12 SASI_Hs01_00068994 predicted 575
13 SASI_Hs01_00068995 predicted 228
14 SASI_Hs01_00068998 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078223 predicted 1817
2 SASI_Rn01_00078225 predicted 717
3 SASI_Rn01_00078226 predicted 840
4 SASI_Rn01_00078227 predicted 226
5 SASI_Rn01_00078228 predicted 347
6 SASI_Rn01_00078229 predicted 1894
7 SASI_Rn01_00078230 predicted 852
8 SASI_Rn01_00078231 predicted 320
9 SASI_Rn01_00078232 predicted 1843
10 SASI_Rn02_00270128 predicted 696
11 SASI_Rn01_00078224 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309569 predicted 497
2 SASI_Mm02_00309570 predicted 856
3 SASI_Mm02_00309571 predicted 1137
4 SASI_Mm02_00309572 predicted 519
5 SASI_Mm02_00309573 predicted 1267
6 SASI_Mm02_00309574 predicted 872
7 SASI_Mm02_00309575 predicted 344
8 SASI_Mm02_00309576 predicted 510
9 SASI_Mm02_00309577 predicted 1642
10 SASI_Mm02_00309578 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309579 predicted 738
2 SASI_Mm02_00309580 predicted 1102
3 SASI_Mm02_00309581 predicted 1386
4 SASI_Mm02_00309582 predicted 765
5 SASI_Mm02_00309583 predicted 1517
6 SASI_Mm02_00309584 predicted 1118
7 SASI_Mm02_00309585 predicted 587
8 SASI_Mm02_00309586 predicted 756
9 SASI_Mm02_00309587 predicted 1890
10 SASI_Mm02_00309588 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140697 predicted 692
2 SASI_Mm01_00140698 predicted 1053
3 SASI_Mm01_00140699 predicted 326
4 SASI_Mm01_00140700 predicted 1340
5 SASI_Mm01_00140701 predicted 318
6 SASI_Mm01_00140702 predicted 718
7 SASI_Mm01_00140703 predicted 1471
8 SASI_Mm01_00140706 predicted 1074
9 SASI_Mm02_00318675 predicted 704
10 SASI_Mm02_00318676 predicted 1840
11 SASI_Mm01_00140704 predicted 826
12 SASI_Mm01_00140705 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016287
VALIDATED
HP1BP3 MISSION shRNA Bacterial Glycerol Stock
heterochromatin protein 1, binding protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016287.1-1012s1c1
Sequence:CCGGGTTAGAACAGATAACTGGCAACTCGAGTTGCCAGTTATCTGTTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-1190s1c1
Sequence:CCGGCCAGGAACCAATTCTAACTATCTCGAGATAGTTAGAATTGGTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-1093s1c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016287.1-1611s1c1
Sequence:CCGGCCACAGTCATCAAGAAACCTACTCGAGTAGGTTTCTTGATGACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-107s1c1
Sequence:CCGGCCTAAGGCACTCCCACTTATACTCGAGTATAAGTGGGAGTGCCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-558s1c1
Sequence:CCGGCAATCTTAACTGAGGCCATTACTCGAGTAATGGCCTCAGTTAAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-1678s21c1
Sequence:CCGGCCACAGTCATCAAGAAACCTACTCGAGTAGGTTTCTTGATGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-1948s21c1
Sequence:CCGGTTTAGGCATTTGCTAGCTTTACTCGAGTAAAGCTAGCAAATGCCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-780s21c1
Sequence:CCGGGGAGTCATCAAACAGGTTAAACTCGAGTTTAACCTGTTTGATGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-628s21c1
Sequence:CCGGCAATCTTAACTGAGGCCATTACTCGAGTAATGGCCTCAGTTAAGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016287.3-942s21c1
Sequence:CCGGACTCGCCTTTGTGAACCTAAACTCGAGTTTAGGTTCACAAAGGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016287
VALIDATED
HP1BP3 MISSION shRNA shRNA Plasmid DNA
heterochromatin protein 1, binding protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016287.1-1012s1c1
Sequence:CCGGGTTAGAACAGATAACTGGCAACTCGAGTTGCCAGTTATCTGTTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-1190s1c1
Sequence:CCGGCCAGGAACCAATTCTAACTATCTCGAGATAGTTAGAATTGGTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-1093s1c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016287.1-1611s1c1
Sequence:CCGGCCACAGTCATCAAGAAACCTACTCGAGTAGGTTTCTTGATGACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-107s1c1
Sequence:CCGGCCTAAGGCACTCCCACTTATACTCGAGTATAAGTGGGAGTGCCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-558s1c1
Sequence:CCGGCAATCTTAACTGAGGCCATTACTCGAGTAATGGCCTCAGTTAAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-1678s21c1
Sequence:CCGGCCACAGTCATCAAGAAACCTACTCGAGTAGGTTTCTTGATGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-1948s21c1
Sequence:CCGGTTTAGGCATTTGCTAGCTTTACTCGAGTAAAGCTAGCAAATGCCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-780s21c1
Sequence:CCGGGGAGTCATCAAACAGGTTAAACTCGAGTTTAACCTGTTTGATGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-628s21c1
Sequence:CCGGCAATCTTAACTGAGGCCATTACTCGAGTAATGGCCTCAGTTAAGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016287.3-942s21c1
Sequence:CCGGACTCGCCTTTGTGAACCTAAACTCGAGTTTAGGTTCACAAAGGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016287
VALIDATED
HP1BP3 MISSION shRNA Lentiviral Transduction Particles
heterochromatin protein 1, binding protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016287.1-1012s1c1
Sequence:CCGGGTTAGAACAGATAACTGGCAACTCGAGTTGCCAGTTATCTGTTCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-1190s1c1
Sequence:CCGGCCAGGAACCAATTCTAACTATCTCGAGATAGTTAGAATTGGTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-1093s1c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016287.1-1611s1c1
Sequence:CCGGCCACAGTCATCAAGAAACCTACTCGAGTAGGTTTCTTGATGACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-107s1c1
Sequence:CCGGCCTAAGGCACTCCCACTTATACTCGAGTATAAGTGGGAGTGCCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016287.1-558s1c1
Sequence:CCGGCAATCTTAACTGAGGCCATTACTCGAGTAATGGCCTCAGTTAAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-1678s21c1
Sequence:CCGGCCACAGTCATCAAGAAACCTACTCGAGTAGGTTTCTTGATGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-1948s21c1
Sequence:CCGGTTTAGGCATTTGCTAGCTTTACTCGAGTAAAGCTAGCAAATGCCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-780s21c1
Sequence:CCGGGGAGTCATCAAACAGGTTAAACTCGAGTTTAACCTGTTTGATGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016287.3-628s21c1
Sequence:CCGGCAATCTTAACTGAGGCCATTACTCGAGTAATGGCCTCAGTTAAGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016287.3-942s21c1
Sequence:CCGGACTCGCCTTTGTGAACCTAAACTCGAGTTTAGGTTCACAAAGGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010470
VALIDATED
HP1BP3 MISSION shRNA Bacterial Glycerol Stock
heterochromatin protein 1, binding protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-2842s1c1
Sequence:CCGGGCCCTCTTCTTGTTTGTATTTCTCGAGAAATACAAACAAGAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-662s1c1
Sequence:CCGGCCCAAGATGGACGCAATCTTACTCGAGTAAGATTGCGTCCATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-260s1c1
Sequence:CCGGGCGGACAAGTTAGGTGAGAAACTCGAGTTTCTCACCTAACTTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-1201s1c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-1819s1c1
Sequence:CCGGGAAGAAGTCTTTCAAGACAAACTCGAGTTTGTCTTGAAAGACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010470.2-2876s21c1
Sequence:CCGGGCCCTCTTCTTGTTTGTATTTCTCGAGAAATACAAACAAGAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-697s21c1
Sequence:CCGGCCCAAGATGGACGCAATCTTACTCGAGTAAGATTGCGTCCATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-1854s21c1
Sequence:CCGGGAAGAAGTCTTTCAAGACAAACTCGAGTTTGTCTTGAAAGACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-1236s21c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010470
VALIDATED
HP1BP3 MISSION shRNA shRNA Plasmid DNA
heterochromatin protein 1, binding protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-2842s1c1
Sequence:CCGGGCCCTCTTCTTGTTTGTATTTCTCGAGAAATACAAACAAGAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-662s1c1
Sequence:CCGGCCCAAGATGGACGCAATCTTACTCGAGTAAGATTGCGTCCATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-260s1c1
Sequence:CCGGGCGGACAAGTTAGGTGAGAAACTCGAGTTTCTCACCTAACTTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-1201s1c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-1819s1c1
Sequence:CCGGGAAGAAGTCTTTCAAGACAAACTCGAGTTTGTCTTGAAAGACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010470.2-2876s21c1
Sequence:CCGGGCCCTCTTCTTGTTTGTATTTCTCGAGAAATACAAACAAGAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-697s21c1
Sequence:CCGGCCCAAGATGGACGCAATCTTACTCGAGTAAGATTGCGTCCATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-1854s21c1
Sequence:CCGGGAAGAAGTCTTTCAAGACAAACTCGAGTTTGTCTTGAAAGACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-1236s21c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010470
VALIDATED
HP1BP3 MISSION shRNA Lentiviral Transduction Particles
heterochromatin protein 1, binding protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-2842s1c1
Sequence:CCGGGCCCTCTTCTTGTTTGTATTTCTCGAGAAATACAAACAAGAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-662s1c1
Sequence:CCGGCCCAAGATGGACGCAATCTTACTCGAGTAAGATTGCGTCCATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-260s1c1
Sequence:CCGGGCGGACAAGTTAGGTGAGAAACTCGAGTTTCTCACCTAACTTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-1201s1c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010470.1-1819s1c1
Sequence:CCGGGAAGAAGTCTTTCAAGACAAACTCGAGTTTGTCTTGAAAGACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010470.2-2876s21c1
Sequence:CCGGGCCCTCTTCTTGTTTGTATTTCTCGAGAAATACAAACAAGAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-697s21c1
Sequence:CCGGCCCAAGATGGACGCAATCTTACTCGAGTAAGATTGCGTCCATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-1854s21c1
Sequence:CCGGGAAGAAGTCTTTCAAGACAAACTCGAGTTTGTCTTGAAAGACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010470.2-1236s21c1
Sequence:CCGGCCTGATGGAATATGCAATCTTCTCGAGAAGATTGCATATTCCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)