EMAIL THIS PAGE TO A FRIEND

HP

haptoglobin

80 Gene Product Result for
Synonyms: BP HP2ALPHA2 HPA1S
Species: Human HP(3240), Mouse Hp(15439), Rat Hp(24464), Zebrafish hp(566096), fruit fly hp(251278), dog HP(479668), cow HP(280692), domestic cat HP(100144610), domestic guinea pig Hp(100721435), naked mole-rat Hp(101705743), sheep HP(101102413), Domestic Rabbit HP(100008816)
Gene ID:
Human(3240) Summary: This gene encodes a preproprotein, which is processed to yield both alpha and beta chains, which subsequently combine as a tetramer to produce haptoglobin. Haptoglobin functions to bind free plasma hemoglobin, which allows degradative enzymes to gain access to the hemoglobin, while at the same time preventing loss of iron through the kidneys and protecting the kidneys from damage by hemoglobin. Mutations in this gene and/or its regulatory regions cause ahaptoglobinemia or hypohaptoglobinemia. This gene has also been linked to diabetic nephropathy, the incidence of coronary artery disease in type 1 diabetes, Crohn's disease, inflammatory disease behavior, primary sclerosing cholangitis, susceptibility to idiopathic Parkinson's disease, and a reduced incidence of Plasmodium falciparum malaria. A similar duplicated gene is located next to this gene on chromosome 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15439) haptoglobin
Rat(24464) haptoglobin
Zebrafish(566096) haptoglobin
dog(479668) haptoglobin
cow(280692) haptoglobin
sheep(101102413) haptoglobin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0509 AQUA Peptide ILGGHLDA[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126102 Rosetta Predictions human pricing
NM_005143 Rosetta Predictions human pricing
NM_012582 Rosetta Predictions rat pricing
NM_017370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328127 predicted 963
2 SASI_Hs02_00328128 predicted 967
3 SASI_Hs02_00328129 predicted 582
4 SASI_Hs02_00328130 predicted 613
5 SASI_Hs02_00328131 predicted 776
6 SASI_Hs02_00328132 predicted 579
7 SASI_Hs02_00328133 predicted 879
8 SASI_Hs02_00328134 predicted 248
9 SASI_Hs02_00328135 predicted 235
10 SASI_Hs02_00328136 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339072 predicted 1144
2 SASI_Hs02_00339073 predicted 1143
3 SASI_Hs02_00339074 predicted 759
4 SASI_Hs01_00241746 predicted 798
5 SASI_Hs02_00339075 predicted 950
6 SASI_Hs01_00241747 predicted 760
7 SASI_Hs02_00339076 predicted 1057
8 SASI_Hs02_00339077 predicted 414
9 SASI_Hs01_00241741 predicted 333
10 SASI_Hs01_00241742 predicted 781
11 SASI_Hs01_00241743 predicted 738
12 SASI_Hs01_00241744 predicted 1190
13 SASI_Hs01_00241745 predicted 242
14 SASI_Hs01_00241748 predicted 581
15 SASI_Hs01_00241749 predicted 431
16 SASI_Hs01_00241750 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033959 predicted 342
2 SASI_Rn01_00033967 predicted 322
3 SASI_Rn02_00259718 predicted 350
4 SASI_Rn02_00259719 predicted 266
5 SASI_Rn01_00033958 predicted 688
6 SASI_Rn02_00259720 predicted 571
7 SASI_Rn01_00033960 predicted 710
8 SASI_Rn01_00033962 predicted 904
9 SASI_Rn01_00033963 predicted 616
10 SASI_Rn02_00259721 predicted 201
11 SASI_Rn01_00033961 predicted 786
12 SASI_Rn01_00033964 predicted 955
13 SASI_Rn01_00033965 predicted 689
14 SASI_Rn01_00033966 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057844 predicted 598
2 SASI_Mm01_00057845 predicted 251
3 SASI_Mm02_00323848 predicted 306
4 SASI_Mm01_00057846 predicted 347
5 SASI_Mm02_00323849 predicted 385
6 SASI_Mm01_00057850 predicted 732
7 SASI_Mm02_00323850 predicted 596
8 SASI_Mm01_00057852 predicted 215
9 SASI_Mm01_00057853 predicted 432
10 SASI_Mm02_00323851 predicted 615
11 SASI_Mm01_00057847 predicted 990
12 SASI_Mm01_00057848 predicted 937
13 SASI_Mm01_00057849 predicted 659
14 SASI_Mm01_00057851 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017370
HP MISSION shRNA Bacterial Glycerol Stock
haptoglobin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017370.2-1127s21c1
Sequence:CCGGTGTCGCTGAGTATGGTGTGTACTCGAGTACACACCATACTCAGCGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017370.2-289s21c1
Sequence:CCGGTGGAGCACTTGGTTCGCTATCCTCGAGGATAGCGAACCAAGTGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017370.1-1099s1c1
Sequence:CCGGGCTCACTAGAAGGCTGCACATCTCGAGATGTGCAGCCTTCTAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-157s1c1
Sequence:CCGGCCAGAGATTGCAAACGGCTATCTCGAGATAGCCGTTTGCAATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-669s1c1
Sequence:CCGGCCTGCCTTCCAAAGACTACATCTCGAGATGTAGTCTTTGGAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-243s1c1
Sequence:CCGGGTACACCTTAAACGACGAGAACTCGAGTTCTCGTCGTTTAAGGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-733s1c1
Sequence:CCGGGCCAACTTTAGATTTACCGATCTCGAGATCGGTAAATCTAAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017370
HP MISSION shRNA shRNA Plasmid DNA
haptoglobin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017370.2-1127s21c1
Sequence:CCGGTGTCGCTGAGTATGGTGTGTACTCGAGTACACACCATACTCAGCGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017370.2-289s21c1
Sequence:CCGGTGGAGCACTTGGTTCGCTATCCTCGAGGATAGCGAACCAAGTGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017370.1-1099s1c1
Sequence:CCGGGCTCACTAGAAGGCTGCACATCTCGAGATGTGCAGCCTTCTAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-157s1c1
Sequence:CCGGCCAGAGATTGCAAACGGCTATCTCGAGATAGCCGTTTGCAATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-669s1c1
Sequence:CCGGCCTGCCTTCCAAAGACTACATCTCGAGATGTAGTCTTTGGAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-243s1c1
Sequence:CCGGGTACACCTTAAACGACGAGAACTCGAGTTCTCGTCGTTTAAGGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-733s1c1
Sequence:CCGGGCCAACTTTAGATTTACCGATCTCGAGATCGGTAAATCTAAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017370
HP MISSION shRNA Lentiviral Transduction Particles
haptoglobin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017370.2-1127s21c1
Sequence:CCGGTGTCGCTGAGTATGGTGTGTACTCGAGTACACACCATACTCAGCGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017370.2-289s21c1
Sequence:CCGGTGGAGCACTTGGTTCGCTATCCTCGAGGATAGCGAACCAAGTGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017370.1-1099s1c1
Sequence:CCGGGCTCACTAGAAGGCTGCACATCTCGAGATGTGCAGCCTTCTAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-157s1c1
Sequence:CCGGCCAGAGATTGCAAACGGCTATCTCGAGATAGCCGTTTGCAATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-669s1c1
Sequence:CCGGCCTGCCTTCCAAAGACTACATCTCGAGATGTAGTCTTTGGAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-243s1c1
Sequence:CCGGGTACACCTTAAACGACGAGAACTCGAGTTCTCGTCGTTTAAGGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017370.1-733s1c1
Sequence:CCGGGCCAACTTTAGATTTACCGATCTCGAGATCGGTAAATCTAAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005143
HP MISSION shRNA Bacterial Glycerol Stock
haptoglobin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005143.3-1150s21c1
Sequence:CCGGGGTATGCGACTGGGATCTTAACTCGAGTTAAGATCCCAGTCGCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005143.3-293s21c1
Sequence:CCGGTCCTGAATGTGAAGCAGATGACTCGAGTCATCTGCTTCACATTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-828s1c1
Sequence:CCGGCCATCCAAGGATTATGCAGAACTCGAGTTCTGCATAATCCTTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-403s1c1
Sequence:CCGGCCTTAAACAATGAGAAGCAGTCTCGAGACTGCTTCTCATTGTTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-176s1c1
Sequence:CCGGCCAGTGTAAGAACTACTACAACTCGAGTTGTAGTAGTTCTTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-945s1c1
Sequence:CCGGGACCAATGCATAAGGCATTATCTCGAGATAATGCCTTATGCATTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-744s1c1
Sequence:CCGGCCTAACTACTCCCAAGTAGATCTCGAGATCTACTTGGGAGTAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005143
HP MISSION shRNA shRNA Plasmid DNA
haptoglobin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005143.3-1150s21c1
Sequence:CCGGGGTATGCGACTGGGATCTTAACTCGAGTTAAGATCCCAGTCGCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005143.3-293s21c1
Sequence:CCGGTCCTGAATGTGAAGCAGATGACTCGAGTCATCTGCTTCACATTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-828s1c1
Sequence:CCGGCCATCCAAGGATTATGCAGAACTCGAGTTCTGCATAATCCTTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-403s1c1
Sequence:CCGGCCTTAAACAATGAGAAGCAGTCTCGAGACTGCTTCTCATTGTTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-176s1c1
Sequence:CCGGCCAGTGTAAGAACTACTACAACTCGAGTTGTAGTAGTTCTTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-945s1c1
Sequence:CCGGGACCAATGCATAAGGCATTATCTCGAGATAATGCCTTATGCATTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-744s1c1
Sequence:CCGGCCTAACTACTCCCAAGTAGATCTCGAGATCTACTTGGGAGTAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005143
HP MISSION shRNA Lentiviral Transduction Particles
haptoglobin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005143.3-1150s21c1
Sequence:CCGGGGTATGCGACTGGGATCTTAACTCGAGTTAAGATCCCAGTCGCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005143.3-293s21c1
Sequence:CCGGTCCTGAATGTGAAGCAGATGACTCGAGTCATCTGCTTCACATTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-828s1c1
Sequence:CCGGCCATCCAAGGATTATGCAGAACTCGAGTTCTGCATAATCCTTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-403s1c1
Sequence:CCGGCCTTAAACAATGAGAAGCAGTCTCGAGACTGCTTCTCATTGTTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-176s1c1
Sequence:CCGGCCAGTGTAAGAACTACTACAACTCGAGTTGTAGTAGTTCTTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-945s1c1
Sequence:CCGGGACCAATGCATAAGGCATTATCTCGAGATAATGCCTTATGCATTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005143.1-744s1c1
Sequence:CCGGCCTAACTACTCCCAAGTAGATCTCGAGATCTACTTGGGAGTAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)