EMAIL THIS PAGE TO A FRIEND

HPCA

hippocalcin

85 Gene Product Result for
Synonyms: BDR2
UniProtKB ID: P84074, B2R9T3, D3DPQ7, P32076, P41211, P70510
Gene ID:
Human(3208) Summary: The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. This protein is associated with the plasma membrane. It has similarities to proteins located in the photoreceptor cells that regulate photosignal transduction in a calcium-sensitive manner. This protein displays recoverin activity and a calcium-dependent inhibition of rhodopsin kinase. It is identical to the rat and mouse hippocalcin proteins and thought to play an important role in neurons of the central nervous system in a number of species. [provided by RefSeq, Jul 2008]
Mouse(15444) hippocalcin
Rat(29177) hippocalcin
Zebrafish(393696) hippocalcin
cow(509772) hippocalcin
dog(611787) hippocalcin
chicken(419668) hippocalcin
sheep(101110911) hippocalcin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002143 Rosetta Predictions human pricing
NM_017122 Rosetta Predictions rat pricing
XM_001060450 Rosetta Predictions rat pricing
XM_579395 Rosetta Predictions rat pricing
NM_001130419 Rosetta Predictions mouse pricing
NM_010471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114272 predicted 276
2 SASI_Hs01_00114273 predicted 492
3 SASI_Hs01_00114276 predicted 562
4 SASI_Hs01_00114277 predicted 267
5 SASI_Hs01_00114278 predicted 267
6 SASI_Hs01_00114280 predicted 207
7 SASI_Hs01_00114281 predicted 610
8 SASI_Hs02_00333323 predicted 495
9 SASI_Hs02_00333324 predicted 561
10 SASI_Hs02_00333325 predicted 505
11 SASI_Hs01_00114274 predicted 417
12 SASI_Hs01_00114275 predicted 435
13 SASI_Hs01_00114279 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108766 predicted 1019
2 SASI_Rn01_00108767 predicted 628
3 SASI_Rn01_00108768 predicted 1102
4 SASI_Rn01_00108769 predicted 1183
5 SASI_Rn01_00108770 predicted 635
6 SASI_Rn01_00108771 predicted 540
7 SASI_Rn01_00108773 predicted 531
8 SASI_Rn01_00108774 predicted 704
9 SASI_Rn01_00108775 predicted 349
10 SASI_Rn02_00261364 predicted 632
11 SASI_Rn01_00108772 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296554 predicted 384
2 SASI_Rn02_00296555 predicted 619
3 SASI_Rn02_00296556 predicted 387
4 SASI_Rn02_00296557 predicted 440
5 SASI_Rn02_00296558 predicted 247
6 SASI_Rn02_00296559 predicted 440
7 SASI_Rn02_00296560 predicted 312
8 SASI_Rn02_00296561 predicted 318
9 SASI_Rn02_00296562 predicted 270
10 SASI_Rn02_00296563 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181131 predicted 522
2 SASI_Rn01_00181132 predicted 464
3 SASI_Rn01_00181133 predicted 538
4 SASI_Rn01_00181134 predicted 452
5 SASI_Rn01_00181135 predicted 570
6 SASI_Rn01_00181136 predicted 556
7 SASI_Rn01_00181137 predicted 540
8 SASI_Rn01_00181138 predicted 520
9 SASI_Rn01_00181139 predicted 456
10 SASI_Rn01_00181140 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311188 predicted 643
2 SASI_Mm02_00311189 predicted 649
3 SASI_Mm02_00311190 predicted 557
4 SASI_Mm02_00311191 predicted 582
5 SASI_Mm02_00311192 predicted 564
6 SASI_Mm02_00311193 predicted 552
7 SASI_Mm02_00311194 predicted 647
8 SASI_Mm02_00311195 predicted 577
9 SASI_Mm02_00311196 predicted 368
10 SASI_Mm02_00311197 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093522 predicted 547
2 SASI_Mm01_00093523 predicted 550
3 SASI_Mm01_00093524 predicted 453
4 SASI_Mm01_00093525 predicted 474
5 SASI_Mm01_00093526 predicted 465
6 SASI_Mm01_00093527 predicted 446
7 SASI_Mm01_00093528 predicted 549
8 SASI_Mm01_00093529 predicted 479
9 SASI_Mm01_00093530 predicted 270
10 SASI_Mm01_00093531 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010471
HPCA MISSION shRNA Bacterial Glycerol Stock
hippocalcin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010471.3-935s21c1
Sequence:CCGGGAGACAGCTGGATCATCTTACCTCGAGGTAAGATGATCCAGCTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010471.3-727s21c1
Sequence:CCGGTTCCTCTCCCTCGTGTCTATCCTCGAGGATAGACACGAGGGAGAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010471.3-277s21c1
Sequence:CCGGCAAGTTTGCCGAGCACGTCTTCTCGAGAAGACGTGCTCGGCAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010471.3-393s21c1
Sequence:CCGGTCATGTGGGCCTTCAGCATGTCTCGAGACATGCTGAAGGCCCACATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010471.2-1179s1c1
Sequence:CCGGGCACTTAGATAACCACAGATTCTCGAGAATCTGTGGTTATCTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-476s1c1
Sequence:CCGGCCGCCAAATGGACACAAACAACTCGAGTTGTTTGTGTCCATTTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-62s1c1
Sequence:CCGGCCTGCGAGAGAACACGGAGTTCTCGAGAACTCCGTGTTCTCTCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-143s1c1
Sequence:CCGGCCTCAACGTGGATGAGTTCAACTCGAGTTGAACTCATCCACGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-380s1c1
Sequence:CCGGGCTAGAAATTGTGCAGGCCATCTCGAGATGGCCTGCACAATTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010471
HPCA MISSION shRNA shRNA Plasmid DNA
hippocalcin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010471.3-935s21c1
Sequence:CCGGGAGACAGCTGGATCATCTTACCTCGAGGTAAGATGATCCAGCTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010471.3-727s21c1
Sequence:CCGGTTCCTCTCCCTCGTGTCTATCCTCGAGGATAGACACGAGGGAGAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010471.3-277s21c1
Sequence:CCGGCAAGTTTGCCGAGCACGTCTTCTCGAGAAGACGTGCTCGGCAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010471.3-393s21c1
Sequence:CCGGTCATGTGGGCCTTCAGCATGTCTCGAGACATGCTGAAGGCCCACATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010471.2-1179s1c1
Sequence:CCGGGCACTTAGATAACCACAGATTCTCGAGAATCTGTGGTTATCTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-476s1c1
Sequence:CCGGCCGCCAAATGGACACAAACAACTCGAGTTGTTTGTGTCCATTTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-62s1c1
Sequence:CCGGCCTGCGAGAGAACACGGAGTTCTCGAGAACTCCGTGTTCTCTCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-143s1c1
Sequence:CCGGCCTCAACGTGGATGAGTTCAACTCGAGTTGAACTCATCCACGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-380s1c1
Sequence:CCGGGCTAGAAATTGTGCAGGCCATCTCGAGATGGCCTGCACAATTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010471
HPCA MISSION shRNA Lentiviral Transduction Particles
hippocalcin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010471.3-935s21c1
Sequence:CCGGGAGACAGCTGGATCATCTTACCTCGAGGTAAGATGATCCAGCTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010471.3-727s21c1
Sequence:CCGGTTCCTCTCCCTCGTGTCTATCCTCGAGGATAGACACGAGGGAGAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010471.3-277s21c1
Sequence:CCGGCAAGTTTGCCGAGCACGTCTTCTCGAGAAGACGTGCTCGGCAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010471.3-393s21c1
Sequence:CCGGTCATGTGGGCCTTCAGCATGTCTCGAGACATGCTGAAGGCCCACATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010471.2-1179s1c1
Sequence:CCGGGCACTTAGATAACCACAGATTCTCGAGAATCTGTGGTTATCTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-476s1c1
Sequence:CCGGCCGCCAAATGGACACAAACAACTCGAGTTGTTTGTGTCCATTTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-62s1c1
Sequence:CCGGCCTGCGAGAGAACACGGAGTTCTCGAGAACTCCGTGTTCTCTCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-143s1c1
Sequence:CCGGCCTCAACGTGGATGAGTTCAACTCGAGTTGAACTCATCCACGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010471.2-380s1c1
Sequence:CCGGGCTAGAAATTGTGCAGGCCATCTCGAGATGGCCTGCACAATTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002143
HPCA MISSION shRNA Bacterial Glycerol Stock
hippocalcin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-276s21c1
Sequence:CCGGCCATAGACTTTCGGGAGTTCACTCGAGTGAACTCCCGAAAGTCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-165s21c1
Sequence:CCGGTCCTCAATGTGGATGAGTTCACTCGAGTGAACTCATCCACATTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-342s21c1
Sequence:CCGGTCATGTGGGCCTTCAGCATGTCTCGAGACATGCTGAAGGCCCACATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-430s21c1
Sequence:CCGGGATGGTTTCGTCCGTGATGAACTCGAGTTCATCACGGACGAAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002143.2-788s1c1
Sequence:CCGGGCCAAAGCAAGTAAGCGGTTACTCGAGTAACCGCTTACTTGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-498s1c1
Sequence:CCGGTCCGCCAAATGGACACAAACACTCGAGTGTTTGTGTCCATTTGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-251s1c1
Sequence:CCGGACCTTTGACACCAACAGCGATCTCGAGATCGCTGTTGGTGTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-94s1c1
Sequence:CCGGGAACACAGAGTTCTCAGAGCTCTCGAGAGCTCTGAGAACTCTGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-568s1c1
Sequence:CCGGCCCGTCCATCGTGCGTCTGCTCTCGAGAGCAGACGCACGATGGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002143
HPCA MISSION shRNA shRNA Plasmid DNA
hippocalcin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-276s21c1
Sequence:CCGGCCATAGACTTTCGGGAGTTCACTCGAGTGAACTCCCGAAAGTCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-165s21c1
Sequence:CCGGTCCTCAATGTGGATGAGTTCACTCGAGTGAACTCATCCACATTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-342s21c1
Sequence:CCGGTCATGTGGGCCTTCAGCATGTCTCGAGACATGCTGAAGGCCCACATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-430s21c1
Sequence:CCGGGATGGTTTCGTCCGTGATGAACTCGAGTTCATCACGGACGAAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002143.2-788s1c1
Sequence:CCGGGCCAAAGCAAGTAAGCGGTTACTCGAGTAACCGCTTACTTGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-498s1c1
Sequence:CCGGTCCGCCAAATGGACACAAACACTCGAGTGTTTGTGTCCATTTGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-251s1c1
Sequence:CCGGACCTTTGACACCAACAGCGATCTCGAGATCGCTGTTGGTGTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-94s1c1
Sequence:CCGGGAACACAGAGTTCTCAGAGCTCTCGAGAGCTCTGAGAACTCTGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-568s1c1
Sequence:CCGGCCCGTCCATCGTGCGTCTGCTCTCGAGAGCAGACGCACGATGGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002143
HPCA MISSION shRNA Lentiviral Transduction Particles
hippocalcin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-276s21c1
Sequence:CCGGCCATAGACTTTCGGGAGTTCACTCGAGTGAACTCCCGAAAGTCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-165s21c1
Sequence:CCGGTCCTCAATGTGGATGAGTTCACTCGAGTGAACTCATCCACATTGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-342s21c1
Sequence:CCGGTCATGTGGGCCTTCAGCATGTCTCGAGACATGCTGAAGGCCCACATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002143.2-430s21c1
Sequence:CCGGGATGGTTTCGTCCGTGATGAACTCGAGTTCATCACGGACGAAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002143.2-788s1c1
Sequence:CCGGGCCAAAGCAAGTAAGCGGTTACTCGAGTAACCGCTTACTTGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-498s1c1
Sequence:CCGGTCCGCCAAATGGACACAAACACTCGAGTGTTTGTGTCCATTTGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-251s1c1
Sequence:CCGGACCTTTGACACCAACAGCGATCTCGAGATCGCTGTTGGTGTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-94s1c1
Sequence:CCGGGAACACAGAGTTCTCAGAGCTCTCGAGAGCTCTGAGAACTCTGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002143.2-568s1c1
Sequence:CCGGCCCGTCCATCGTGCGTCTGCTCTCGAGAGCAGACGCACGATGGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)