EMAIL THIS PAGE TO A FRIEND

HPCAL1

hippocalcin-like 1

64 Gene Product Result for
Synonyms: BDR1 HLP2 VILIP-3
UniProtKB ID: P37235, Q969S5
Gene ID:
Human(3241) Summary: The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(53602) hippocalcin-like 1
Rat(50871) hippocalcin-like 1
domestic guinea pig(100717790) hippocalcin-like 1
naked mole-rat(101699820) hippocalcin-like 1
sheep(100187549) hippocalcin-like 1
chicken(396161) hippocalcin-like 1
cow(513870) hippocalcin-like 1
domestic cat(101087733) hippocalcin-like 1
dog(609787) hippocalcin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002149 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002149 Rosetta Predictions human pricing
NM_134421 Rosetta Predictions human pricing
NM_017356 Rosetta Predictions rat pricing
NM_016677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077132 predicted 986
2 SASI_Hs02_00333334 predicted 983
3 SASI_Hs01_00077133 predicted 1196
4 SASI_Hs01_00077134 predicted 1190
5 SASI_Hs01_00077135 predicted 816
6 SASI_Hs01_00077136 predicted 1418
7 SASI_Hs01_00077137 predicted 993
8 SASI_Hs01_00077138 predicted 1186
9 SASI_Hs01_00077139 predicted 1315
10 SASI_Hs01_00077140 predicted 1003
11 SASI_Hs01_00077141 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017874 predicted 1141
2 SASI_Hs02_00363312 predicted 1134
3 SASI_Hs01_00017875 predicted 1344
4 SASI_Hs01_00017876 predicted 1341
5 SASI_Hs01_00017877 predicted 966
6 SASI_Hs01_00017878 predicted 1571
7 SASI_Hs01_00017879 predicted 1154
8 SASI_Hs01_00017880 predicted 1343
9 SASI_Hs01_00017881 predicted 1475
10 SASI_Hs01_00017882 predicted 1151
11 SASI_Hs01_00017883 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261846 predicted 765
2 SASI_Rn01_00036933 predicted 451
3 SASI_Rn01_00036935 predicted 451
4 SASI_Rn01_00036936 predicted 1081
5 SASI_Rn01_00036937 predicted 670
6 SASI_Rn01_00036938 predicted 1405
7 SASI_Rn01_00036939 predicted 1191
8 SASI_Rn01_00036940 predicted 827
9 SASI_Rn01_00036941 predicted 789
10 SASI_Rn01_00036942 predicted 513
11 SASI_Rn01_00036934 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323311 predicted 554
2 SASI_Mm02_00323312 predicted 880
3 SASI_Mm01_00197280 predicted 566
4 SASI_Mm02_00323313 predicted 880
5 SASI_Mm01_00197281 predicted 1114
6 SASI_Mm01_00197282 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002149
VALIDATED
HPCAL1 MISSION shRNA Bacterial Glycerol Stock
hippocalcin-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-843s1c1
Sequence:CCGGGACACCAACAATGACGGCAAACTCGAGTTTGCCGTCATTGTTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-551s1c1
Sequence:CCGGCGACGCTTCCAAGTTCGCCGACTCGAGTCGGCGAACTTGGAAGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002149.2-428s1c1
Sequence:CCGGGAACACGGAGTTCACCGACCACTCGAGTGGTCGGTGAACTCCGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002149.2-860s1c1
Sequence:CCGGCAAACTGTCCTTGGAAGAATTCTCGAGAATTCTTCCAAGGACAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-806s1c1
Sequence:CCGGCCCGGAGAAGCGCACAGACAACTCGAGTTGTCTGTGCGCTTCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-503s21c1
Sequence:CCGGGACCGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002149.2-989s21c1
Sequence:CCGGCAGGCTTGTCGTGCCGTTTAACTCGAGTTAAACGGCACGACAAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-835s21c1
Sequence:CCGGGGCAGATGGACACCAACAATGCTCGAGCATTGTTGGTGTCCATCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002149.2-1420s21c1
Sequence:CCGGGCCGCTTGCACGTATAGATACCTCGAGGTATCTATACGTGCAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-428s21c1
Sequence:CCGGGAACACGGAGTTCACCGACCACTCGAGTGGTCGGTGAACTCCGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-860s21c1
Sequence:CCGGCAAACTGTCCTTGGAAGAATTCTCGAGAATTCTTCCAAGGACAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002149
VALIDATED
HPCAL1 MISSION shRNA shRNA Plasmid DNA
hippocalcin-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-843s1c1
Sequence:CCGGGACACCAACAATGACGGCAAACTCGAGTTTGCCGTCATTGTTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-551s1c1
Sequence:CCGGCGACGCTTCCAAGTTCGCCGACTCGAGTCGGCGAACTTGGAAGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002149.2-428s1c1
Sequence:CCGGGAACACGGAGTTCACCGACCACTCGAGTGGTCGGTGAACTCCGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002149.2-860s1c1
Sequence:CCGGCAAACTGTCCTTGGAAGAATTCTCGAGAATTCTTCCAAGGACAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-806s1c1
Sequence:CCGGCCCGGAGAAGCGCACAGACAACTCGAGTTGTCTGTGCGCTTCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-503s21c1
Sequence:CCGGGACCGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002149.2-989s21c1
Sequence:CCGGCAGGCTTGTCGTGCCGTTTAACTCGAGTTAAACGGCACGACAAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-835s21c1
Sequence:CCGGGGCAGATGGACACCAACAATGCTCGAGCATTGTTGGTGTCCATCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002149.2-1420s21c1
Sequence:CCGGGCCGCTTGCACGTATAGATACCTCGAGGTATCTATACGTGCAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-428s21c1
Sequence:CCGGGAACACGGAGTTCACCGACCACTCGAGTGGTCGGTGAACTCCGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-860s21c1
Sequence:CCGGCAAACTGTCCTTGGAAGAATTCTCGAGAATTCTTCCAAGGACAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002149
VALIDATED
HPCAL1 MISSION shRNA Lentiviral Transduction Particles
hippocalcin-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-843s1c1
Sequence:CCGGGACACCAACAATGACGGCAAACTCGAGTTTGCCGTCATTGTTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-551s1c1
Sequence:CCGGCGACGCTTCCAAGTTCGCCGACTCGAGTCGGCGAACTTGGAAGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002149.2-428s1c1
Sequence:CCGGGAACACGGAGTTCACCGACCACTCGAGTGGTCGGTGAACTCCGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002149.2-860s1c1
Sequence:CCGGCAAACTGTCCTTGGAAGAATTCTCGAGAATTCTTCCAAGGACAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002149.2-806s1c1
Sequence:CCGGCCCGGAGAAGCGCACAGACAACTCGAGTTGTCTGTGCGCTTCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-503s21c1
Sequence:CCGGGACCGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002149.2-989s21c1
Sequence:CCGGCAGGCTTGTCGTGCCGTTTAACTCGAGTTAAACGGCACGACAAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-835s21c1
Sequence:CCGGGGCAGATGGACACCAACAATGCTCGAGCATTGTTGGTGTCCATCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002149.2-1420s21c1
Sequence:CCGGGCCGCTTGCACGTATAGATACCTCGAGGTATCTATACGTGCAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-428s21c1
Sequence:CCGGGAACACGGAGTTCACCGACCACTCGAGTGGTCGGTGAACTCCGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002149.2-860s21c1
Sequence:CCGGCAAACTGTCCTTGGAAGAATTCTCGAGAATTCTTCCAAGGACAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016677
VALIDATED
HPCAL1 MISSION shRNA Bacterial Glycerol Stock
hippocalcin-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-1024s1c1
Sequence:CCGGCCTTCCAATGGTTCAAGTGTTCTCGAGAACACTTGAACCATTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016677.1-612s1c1
Sequence:CCGGCGCAGTGAAATGCTGGAGATACTCGAGTATCTCCAGCATTTCACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016677.1-729s1c1
Sequence:CCGGGACACAAACAATGATGGCAAACTCGAGTTTGCCATCATTGTTTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-389s1c1
Sequence:CCGGGACTGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-305s1c1
Sequence:CCGGCCTGCGGGAACACACGGAATTCTCGAGAATTCCGTGTGTTCCCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1114s21c1
Sequence:CCGGTATCTTACCAAGACCAGCTAACTCGAGTTAGCTGGTCTTGGTAAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1299s21c1
Sequence:CCGGTACGGTGAGATGGACTATAATCTCGAGATTATAGTCCATCTCACCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-570s21c1
Sequence:CCGGTTTAGCATGTACGACCTGGACCTCGAGGTCCAGGTCGTACATGCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-386s21c1
Sequence:CCGGGACTGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1021s21c1
Sequence:CCGGCCTTCCAATGGTTCAAGTGTTCTCGAGAACACTTGAACCATTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016677
VALIDATED
HPCAL1 MISSION shRNA shRNA Plasmid DNA
hippocalcin-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-1024s1c1
Sequence:CCGGCCTTCCAATGGTTCAAGTGTTCTCGAGAACACTTGAACCATTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016677.1-612s1c1
Sequence:CCGGCGCAGTGAAATGCTGGAGATACTCGAGTATCTCCAGCATTTCACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016677.1-729s1c1
Sequence:CCGGGACACAAACAATGATGGCAAACTCGAGTTTGCCATCATTGTTTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-389s1c1
Sequence:CCGGGACTGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-305s1c1
Sequence:CCGGCCTGCGGGAACACACGGAATTCTCGAGAATTCCGTGTGTTCCCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1114s21c1
Sequence:CCGGTATCTTACCAAGACCAGCTAACTCGAGTTAGCTGGTCTTGGTAAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1299s21c1
Sequence:CCGGTACGGTGAGATGGACTATAATCTCGAGATTATAGTCCATCTCACCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-570s21c1
Sequence:CCGGTTTAGCATGTACGACCTGGACCTCGAGGTCCAGGTCGTACATGCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-386s21c1
Sequence:CCGGGACTGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1021s21c1
Sequence:CCGGCCTTCCAATGGTTCAAGTGTTCTCGAGAACACTTGAACCATTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016677
VALIDATED
HPCAL1 MISSION shRNA Lentiviral Transduction Particles
hippocalcin-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-1024s1c1
Sequence:CCGGCCTTCCAATGGTTCAAGTGTTCTCGAGAACACTTGAACCATTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016677.1-612s1c1
Sequence:CCGGCGCAGTGAAATGCTGGAGATACTCGAGTATCTCCAGCATTTCACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016677.1-729s1c1
Sequence:CCGGGACACAAACAATGATGGCAAACTCGAGTTTGCCATCATTGTTTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-389s1c1
Sequence:CCGGGACTGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016677.1-305s1c1
Sequence:CCGGCCTGCGGGAACACACGGAATTCTCGAGAATTCCGTGTGTTCCCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1114s21c1
Sequence:CCGGTATCTTACCAAGACCAGCTAACTCGAGTTAGCTGGTCTTGGTAAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1299s21c1
Sequence:CCGGTACGGTGAGATGGACTATAATCTCGAGATTATAGTCCATCTCACCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-570s21c1
Sequence:CCGGTTTAGCATGTACGACCTGGACCTCGAGGTCCAGGTCGTACATGCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-386s21c1
Sequence:CCGGGACTGTGGACGAGTTCAAGAACTCGAGTTCTTGAACTCGTCCACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016677.4-1021s21c1
Sequence:CCGGCCTTCCAATGGTTCAAGTGTTCTCGAGAACACTTGAACCATTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)