EMAIL THIS PAGE TO A FRIEND

HPCAL4

hippocalcin like 4

233 Gene Product Result for
Synonyms: HLP4
UniProtKB ID: Q9UM19, B2R5U2, D3DPU1, Q5TG97, Q8N611
Gene ID:
Human(51440) Summary: The protein encoded by this gene is highly similar to human hippocalcin protein and hippocalcin like-1 protein. It also has similarity to rat neural visinin-like Ca2+-binding protein-type 1 and 2 proteins. This encoded protein may be involved in the calcium-dependent regulation of rhodopsin phosphorylation. The transcript of this gene has multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Mouse(170638) hippocalcin-like 4
Rat(50872) hippocalcin-like 4
Zebrafish(564909) hippocalcin like 4
dog(607789) hippocalcin like 4
cow(531339) hippocalcin like 4
domestic cat(101096249) hippocalcin like 4
chicken(419676) hippocalcin like 4
sheep(101119857) hippocalcin like 4
domestic guinea pig(100724150) hippocalcin like 4
naked mole-rat(101715230) hippocalcin like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038761 MISSION® esiRNA esiRNA human HPCAL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016257 Rosetta Predictions human pricing
NM_017357 Rosetta Predictions rat pricing
NM_174998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182493 predicted 597
2 SASI_Hs01_00182494 predicted 320
3 SASI_Hs01_00182495 predicted 916
4 SASI_Hs01_00182496 predicted 367
5 SASI_Hs01_00182497 predicted 249
6 SASI_Hs01_00182498 predicted 595
7 SASI_Hs01_00182499 predicted 318
8 SASI_Hs01_00182500 predicted 917
9 SASI_Hs01_00182501 predicted 634
10 SASI_Hs01_00182502 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074336 predicted 205
2 SASI_Rn01_00074337 predicted 366
3 SASI_Rn01_00074338 predicted 440
4 SASI_Rn01_00074339 predicted 438
5 SASI_Rn01_00074340 predicted 314
6 SASI_Rn01_00074341 predicted 382
7 SASI_Rn01_00074342 predicted 211
8 SASI_Rn01_00074343 predicted 320
9 SASI_Rn01_00074344 predicted 317
10 SASI_Rn01_00074345 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345540 predicted 528
2 SASI_Mm01_00050485 predicted 593
3 SASI_Mm02_00345541 predicted 707
4 SASI_Mm01_00050487 predicted 1160
5 SASI_Mm02_00345542 predicted 1140
6 SASI_Mm01_00050488 predicted 471
7 SASI_Mm02_00345543 predicted 1043
8 SASI_Mm02_00345544 predicted 899
9 SASI_Mm01_00050491 predicted 540
10 SASI_Mm02_00345545 predicted 1061
11 SASI_Mm01_00050486 predicted 1160
12 SASI_Mm01_00050489 predicted 630
13 SASI_Mm01_00050490 predicted 306
14 SASI_Mm01_00050492 predicted 372
15 SASI_Mm01_00050493 predicted 487
16 SASI_Mm01_00050494 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174998
HPCAL4 MISSION shRNA Bacterial Glycerol Stock
hippocalcin like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174998.1-1158s1c1
Sequence:CCGGCCCAGGATTATGGTCCAAATACTCGAGTATTTGGACCATAATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-539s1c1
Sequence:CCGGTGGGCCTTTGAGATGTACGATCTCGAGATCGTACATCTCAAAGGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-711s1c1
Sequence:CCGGAGGATAAGGATGACCAGATTACTCGAGTAATCTGGTCATCCTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-305s1c1
Sequence:CCGGCAGGAGCTAAAGCAGTGGTATCTCGAGATACCACTGCTTTAGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-385s1c1
Sequence:CCGGCTATATCAAGTTCTTCCCTTACTCGAGTAAGGGAAGAACTTGATATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174998
HPCAL4 MISSION shRNA shRNA Plasmid DNA
hippocalcin like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174998.1-1158s1c1
Sequence:CCGGCCCAGGATTATGGTCCAAATACTCGAGTATTTGGACCATAATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-539s1c1
Sequence:CCGGTGGGCCTTTGAGATGTACGATCTCGAGATCGTACATCTCAAAGGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-711s1c1
Sequence:CCGGAGGATAAGGATGACCAGATTACTCGAGTAATCTGGTCATCCTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-305s1c1
Sequence:CCGGCAGGAGCTAAAGCAGTGGTATCTCGAGATACCACTGCTTTAGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-385s1c1
Sequence:CCGGCTATATCAAGTTCTTCCCTTACTCGAGTAAGGGAAGAACTTGATATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174998
HPCAL4 MISSION shRNA Lentiviral Transduction Particles
hippocalcin like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174998.1-1158s1c1
Sequence:CCGGCCCAGGATTATGGTCCAAATACTCGAGTATTTGGACCATAATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-539s1c1
Sequence:CCGGTGGGCCTTTGAGATGTACGATCTCGAGATCGTACATCTCAAAGGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-711s1c1
Sequence:CCGGAGGATAAGGATGACCAGATTACTCGAGTAATCTGGTCATCCTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-305s1c1
Sequence:CCGGCAGGAGCTAAAGCAGTGGTATCTCGAGATACCACTGCTTTAGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174998.1-385s1c1
Sequence:CCGGCTATATCAAGTTCTTCCCTTACTCGAGTAAGGGAAGAACTTGATATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016257
HPCAL4 MISSION shRNA Bacterial Glycerol Stock
hippocalcin like 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-675s1c2
Sequence:CCGGGCAGTGTGACATGCAGAAGTACTCGAGTACTTCTGCATGTCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-612s1c1
Sequence:CCGGCCAGATTACATTGGAGGAGTTCTCGAGAACTCCTCCAATGTAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-165s1c1
Sequence:CCGGCCTTGTTCAGAACACTGAGTTCTCGAGAACTCAGTGTTCTGAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-264s1c1
Sequence:CCGGTCAGCAGCTCTACATCAAGTTCTCGAGAACTTGATGTAGAGCTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-643s1c1
Sequence:CCGGGCCAAGAGTGACCCATCCATTCTCGAGAATGGATGGGTCACTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-675s1c1
Sequence:CCGGGCAGTGTGACATGCAGAAGTACTCGAGTACTTCTGCATGTCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016257
HPCAL4 MISSION shRNA shRNA Plasmid DNA
hippocalcin like 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-675s1c2
Sequence:CCGGGCAGTGTGACATGCAGAAGTACTCGAGTACTTCTGCATGTCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-612s1c1
Sequence:CCGGCCAGATTACATTGGAGGAGTTCTCGAGAACTCCTCCAATGTAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-165s1c1
Sequence:CCGGCCTTGTTCAGAACACTGAGTTCTCGAGAACTCAGTGTTCTGAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-264s1c1
Sequence:CCGGTCAGCAGCTCTACATCAAGTTCTCGAGAACTTGATGTAGAGCTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-643s1c1
Sequence:CCGGGCCAAGAGTGACCCATCCATTCTCGAGAATGGATGGGTCACTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-675s1c1
Sequence:CCGGGCAGTGTGACATGCAGAAGTACTCGAGTACTTCTGCATGTCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016257
HPCAL4 MISSION shRNA Lentiviral Transduction Particles
hippocalcin like 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-675s1c2
Sequence:CCGGGCAGTGTGACATGCAGAAGTACTCGAGTACTTCTGCATGTCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-612s1c1
Sequence:CCGGCCAGATTACATTGGAGGAGTTCTCGAGAACTCCTCCAATGTAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-165s1c1
Sequence:CCGGCCTTGTTCAGAACACTGAGTTCTCGAGAACTCAGTGTTCTGAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-264s1c1
Sequence:CCGGTCAGCAGCTCTACATCAAGTTCTCGAGAACTTGATGTAGAGCTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-643s1c1
Sequence:CCGGGCCAAGAGTGACCCATCCATTCTCGAGAATGGATGGGTCACTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016257.2-675s1c1
Sequence:CCGGGCAGTGTGACATGCAGAAGTACTCGAGTACTTCTGCATGTCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)