EMAIL THIS PAGE TO A FRIEND

HPD

4-hydroxyphenylpyruvate dioxygenase

51 Gene Product Result for
Synonyms: 4-HPPD 4HPPD GLOD3 HPPDASE PPD
UniProtKB ID: P32754, A8K461, B3KQ63, Q13234
Gene ID:
Human(3242) Summary: The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria (HAWK). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(15445) 4-hydroxyphenylpyruvic acid dioxygenase
Rat(29531) 4-hydroxyphenylpyruvate dioxygenase
chicken(416852) 4-hydroxyphenylpyruvate dioxygenase
dog(610778) 4-hydroxyphenylpyruvate dioxygenase
cow(516058) 4-hydroxyphenylpyruvate dioxygenase
domestic cat(101093465) 4-hydroxyphenylpyruvate dioxygenase
sheep(101122814) 4-hydroxyphenylpyruvate dioxygenase
Domestic Rabbit(100347363) 4-hydroxyphenylpyruvate dioxygenase
domestic guinea pig(100714633) 4-hydroxyphenylpyruvate dioxygenase
naked mole-rat(101703926) 4-hydroxyphenylpyruvate dioxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002150 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043181 MISSION® esiRNA esiRNA human HPD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002150 Rosetta Predictions human pricing
NM_017233 Rosetta Predictions rat pricing
NM_008277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062575 predicted 793
2 SASI_Hs01_00062576 predicted 1071
3 SASI_Hs01_00062578 predicted 840
4 SASI_Hs01_00062580 predicted 692
5 SASI_Hs01_00062581 predicted 499
6 SASI_Hs01_00062582 predicted 655
7 SASI_Hs01_00062583 predicted 908
8 SASI_Hs02_00333335 predicted 956
9 SASI_Hs01_00062577 predicted 886
10 SASI_Hs01_00062579 predicted 1095
11 SASI_Hs01_00062584 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097888 predicted 296
2 SASI_Rn02_00261602 predicted 405
3 SASI_Rn01_00097889 predicted 1117
4 SASI_Rn01_00097890 predicted 555
5 SASI_Rn01_00097891 predicted 1124
6 SASI_Rn01_00097892 predicted 788
7 SASI_Rn01_00097894 predicted 685
8 SASI_Rn01_00097895 predicted 728
9 SASI_Rn01_00097896 predicted 259
10 SASI_Rn02_00261603 predicted 600
11 SASI_Rn01_00097887 predicted 572
12 SASI_Rn01_00097893 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153349 predicted 527
2 SASI_Mm01_00153350 predicted 1035
3 SASI_Mm01_00153352 predicted 698
4 SASI_Mm01_00153353 predicted 462
5 SASI_Mm01_00153354 predicted 686
6 SASI_Mm01_00153355 predicted 761
7 SASI_Mm01_00153356 predicted 1066
8 SASI_Mm01_00153357 predicted 964
9 SASI_Mm01_00153358 predicted 662
10 SASI_Mm02_00313535 predicted 1086
11 SASI_Mm01_00153351 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008277
HPD MISSION shRNA Bacterial Glycerol Stock
4-hydroxyphenylpyruvate dioxygenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008277.1-1260s1c1
Sequence:CCGGGTCATCTCCAACTGGCTGAAACTCGAGTTTCAGCCAGTTGGAGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-790s1c1
Sequence:CCGGCCAGGAATATGTGGACTATAACTCGAGTTATAGTCCACATATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-620s1c1
Sequence:CCGGGCCTCAGAATGGTACCTGAAACTCGAGTTTCAGGTACCATTCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-254s1c1
Sequence:CCGGGCTCTCAATCCCTGGAACAAACTCGAGTTTGTTCCAGGGATTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-789s1c1
Sequence:CCGGTCCAGGAATATGTGGACTATACTCGAGTATAGTCCACATATTCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008277
HPD MISSION shRNA shRNA Plasmid DNA
4-hydroxyphenylpyruvate dioxygenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008277.1-1260s1c1
Sequence:CCGGGTCATCTCCAACTGGCTGAAACTCGAGTTTCAGCCAGTTGGAGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-790s1c1
Sequence:CCGGCCAGGAATATGTGGACTATAACTCGAGTTATAGTCCACATATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-620s1c1
Sequence:CCGGGCCTCAGAATGGTACCTGAAACTCGAGTTTCAGGTACCATTCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-254s1c1
Sequence:CCGGGCTCTCAATCCCTGGAACAAACTCGAGTTTGTTCCAGGGATTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-789s1c1
Sequence:CCGGTCCAGGAATATGTGGACTATACTCGAGTATAGTCCACATATTCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008277
HPD MISSION shRNA Lentiviral Transduction Particles
4-hydroxyphenylpyruvate dioxygenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008277.1-1260s1c1
Sequence:CCGGGTCATCTCCAACTGGCTGAAACTCGAGTTTCAGCCAGTTGGAGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-790s1c1
Sequence:CCGGCCAGGAATATGTGGACTATAACTCGAGTTATAGTCCACATATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-620s1c1
Sequence:CCGGGCCTCAGAATGGTACCTGAAACTCGAGTTTCAGGTACCATTCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-254s1c1
Sequence:CCGGGCTCTCAATCCCTGGAACAAACTCGAGTTTGTTCCAGGGATTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008277.1-789s1c1
Sequence:CCGGTCCAGGAATATGTGGACTATACTCGAGTATAGTCCACATATTCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002150
HPD MISSION shRNA Bacterial Glycerol Stock
4-hydroxyphenylpyruvate dioxygenase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-914s1c1
Sequence:CCGGCCCTCCACGTACTACAAACAACTCGAGTTGTTTGTAGTACGTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-696s1c1
Sequence:CCGGCGGAATATAGCTCTCTGCGATCTCGAGATCGCAGAGAGCTATATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-572s1c1
Sequence:CCGGCTGGAGATGATCGACCACATTCTCGAGAATGTGGTCGATCATCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-499s1c1
Sequence:CCGGCGGCCAATTCTTGCCTGGATACTCGAGTATCCAGGCAAGAATTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-1123s1c1
Sequence:CCGGCGGCAACTTCAACTCACTGTTCTCGAGAACAGTGAGTTGAAGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002150.2-405s21c1
Sequence:CCGGGGGTAGAGCAAGACAAGTTTGCTCGAGCAAACTTGTCTTGCTCTACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002150.2-888s21c1
Sequence:CCGGAGAGAGGCCTGGAGTTCTTATCTCGAGATAAGAACTCCAGGCCTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002150
HPD MISSION shRNA shRNA Plasmid DNA
4-hydroxyphenylpyruvate dioxygenase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-914s1c1
Sequence:CCGGCCCTCCACGTACTACAAACAACTCGAGTTGTTTGTAGTACGTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-696s1c1
Sequence:CCGGCGGAATATAGCTCTCTGCGATCTCGAGATCGCAGAGAGCTATATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-572s1c1
Sequence:CCGGCTGGAGATGATCGACCACATTCTCGAGAATGTGGTCGATCATCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-499s1c1
Sequence:CCGGCGGCCAATTCTTGCCTGGATACTCGAGTATCCAGGCAAGAATTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-1123s1c1
Sequence:CCGGCGGCAACTTCAACTCACTGTTCTCGAGAACAGTGAGTTGAAGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002150.2-405s21c1
Sequence:CCGGGGGTAGAGCAAGACAAGTTTGCTCGAGCAAACTTGTCTTGCTCTACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002150.2-888s21c1
Sequence:CCGGAGAGAGGCCTGGAGTTCTTATCTCGAGATAAGAACTCCAGGCCTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002150
HPD MISSION shRNA Lentiviral Transduction Particles
4-hydroxyphenylpyruvate dioxygenase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-914s1c1
Sequence:CCGGCCCTCCACGTACTACAAACAACTCGAGTTGTTTGTAGTACGTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-696s1c1
Sequence:CCGGCGGAATATAGCTCTCTGCGATCTCGAGATCGCAGAGAGCTATATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-572s1c1
Sequence:CCGGCTGGAGATGATCGACCACATTCTCGAGAATGTGGTCGATCATCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-499s1c1
Sequence:CCGGCGGCCAATTCTTGCCTGGATACTCGAGTATCCAGGCAAGAATTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002150.2-1123s1c1
Sequence:CCGGCGGCAACTTCAACTCACTGTTCTCGAGAACAGTGAGTTGAAGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002150.2-405s21c1
Sequence:CCGGGGGTAGAGCAAGACAAGTTTGCTCGAGCAAACTTGTCTTGCTCTACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002150.2-888s21c1
Sequence:CCGGAGAGAGGCCTGGAGTTCTTATCTCGAGATAAGAACTCCAGGCCTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)