EMAIL THIS PAGE TO A FRIEND

HPDL

4-hydroxyphenylpyruvate dioxygenase-like

50 Gene Product Result for
Synonyms: 4-HPPD-L GLOXD1 RP4-534D1.1
UniProtKB ID: Q96IR7, B2R9B0
Gene ID:
Mouse(242642) 4-hydroxyphenylpyruvate dioxygenase-like
Rat(313521) 4-hydroxyphenylpyruvate dioxygenase-like
chicken(429095) 4-hydroxyphenylpyruvate dioxygenase-like
chicken(101666990) 4-hydroxyphenylpyruvate dioxygenase-like
domestic cat(101089630) 4-hydroxyphenylpyruvate dioxygenase-like
cow(513050) 4-hydroxyphenylpyruvate dioxygenase-like
dog(482516) 4-hydroxyphenylpyruvate dioxygenase-like
chicken(101748258) 4-hydroxyphenylpyruvate dioxygenase-like
domestic guinea pig(100712787) 4-hydroxyphenylpyruvate dioxygenase-like
naked mole-rat(101708224) 4-hydroxyphenylpyruvate dioxygenase-like
sheep(101119084) 4-hydroxyphenylpyruvate dioxygenase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032756 Rosetta Predictions human pricing
NM_001014068 Rosetta Predictions rat pricing
NM_146256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091857 predicted 1229
2 SASI_Hs01_00091858 predicted 1208
3 SASI_Hs01_00091859 predicted 1466
4 SASI_Hs01_00091860 predicted 1505
5 SASI_Hs01_00091862 predicted 620
6 SASI_Hs01_00091863 predicted 1204
7 SASI_Hs01_00091864 predicted 1184
8 SASI_Hs01_00091865 predicted 1539
9 SASI_Hs02_00360303 predicted 872
10 SASI_Hs02_00360304 predicted 647
11 SASI_Hs01_00091861 predicted 1051
12 SASI_Hs01_00091866 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035625 predicted 1028
2 SASI_Rn02_00201471 predicted 593
3 SASI_Rn01_00035626 predicted 1139
4 SASI_Rn01_00035627 predicted 947
5 SASI_Rn01_00035628 predicted 1106
6 SASI_Rn01_00035629 predicted 1011
7 SASI_Rn01_00035630 predicted 1071
8 SASI_Rn01_00035631 predicted 889
9 SASI_Rn01_00035632 predicted 785
10 SASI_Rn01_00035634 predicted 868
11 SASI_Rn01_00035633 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194489 predicted 1148
2 SASI_Mm01_00194490 predicted 604
3 SASI_Mm01_00194491 predicted 1035
4 SASI_Mm01_00194492 predicted 1172
5 SASI_Mm01_00194493 predicted 889
6 SASI_Mm01_00194494 predicted 1021
7 SASI_Mm01_00194495 predicted 951
8 SASI_Mm01_00194496 predicted 796
9 SASI_Mm02_00341998 predicted 601
10 SASI_Mm02_00341999 predicted 1020
11 SASI_Mm01_00194497 predicted 1186
12 SASI_Mm01_00194498 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032756
HPDL MISSION shRNA Bacterial Glycerol Stock
4-hydroxyphenylpyruvate dioxygenase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032756.2-1352s21c1
Sequence:CCGGAGTCCGTACAGGAGCAATCTGCTCGAGCAGATTGCTCCTGTACGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032756.2-878s21c1
Sequence:CCGGTCGAAATGACAGCAGGGTTTGCTCGAGCAAACCCTGCTGTCATTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1278s1c1
Sequence:CCGGCACTTTCTTCCTGGAGCTGATCTCGAGATCAGCTCCAGGAAGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032756.2-1535s1c1
Sequence:CCGGCCAGAAGCTGTGTCTCTCATTCTCGAGAATGAGAGACACAGCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032756.2-1442s1c1
Sequence:CCGGCAGCACAGAACTGAGGAACATCTCGAGATGTTCCTCAGTTCTGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1232s1c1
Sequence:CCGGGCAAGTTTCTGCTTCAGGTCTCTCGAGAGACCTGAAGCAGAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1233s1c1
Sequence:CCGGCAAGTTTCTGCTTCAGGTCTTCTCGAGAAGACCTGAAGCAGAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1209s1c1
Sequence:CCGGGATCCTGCTAGATGGTGATAACTCGAGTTATCACCATCTAGCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1225s1c1
Sequence:CCGGGATAAAGGCAAGTTTCTGCTTCTCGAGAAGCAGAAACTTGCCTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1215s1c1
Sequence:CCGGGCTAGATGGTGATAAAGGCAACTCGAGTTGCCTTTATCACCATCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032756
HPDL MISSION shRNA shRNA Plasmid DNA
4-hydroxyphenylpyruvate dioxygenase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032756.2-1352s21c1
Sequence:CCGGAGTCCGTACAGGAGCAATCTGCTCGAGCAGATTGCTCCTGTACGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032756.2-878s21c1
Sequence:CCGGTCGAAATGACAGCAGGGTTTGCTCGAGCAAACCCTGCTGTCATTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1278s1c1
Sequence:CCGGCACTTTCTTCCTGGAGCTGATCTCGAGATCAGCTCCAGGAAGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032756.2-1535s1c1
Sequence:CCGGCCAGAAGCTGTGTCTCTCATTCTCGAGAATGAGAGACACAGCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032756.2-1442s1c1
Sequence:CCGGCAGCACAGAACTGAGGAACATCTCGAGATGTTCCTCAGTTCTGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1232s1c1
Sequence:CCGGGCAAGTTTCTGCTTCAGGTCTCTCGAGAGACCTGAAGCAGAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1233s1c1
Sequence:CCGGCAAGTTTCTGCTTCAGGTCTTCTCGAGAAGACCTGAAGCAGAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1209s1c1
Sequence:CCGGGATCCTGCTAGATGGTGATAACTCGAGTTATCACCATCTAGCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1225s1c1
Sequence:CCGGGATAAAGGCAAGTTTCTGCTTCTCGAGAAGCAGAAACTTGCCTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1215s1c1
Sequence:CCGGGCTAGATGGTGATAAAGGCAACTCGAGTTGCCTTTATCACCATCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032756
HPDL MISSION shRNA Lentiviral Transduction Particles
4-hydroxyphenylpyruvate dioxygenase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032756.2-1352s21c1
Sequence:CCGGAGTCCGTACAGGAGCAATCTGCTCGAGCAGATTGCTCCTGTACGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032756.2-878s21c1
Sequence:CCGGTCGAAATGACAGCAGGGTTTGCTCGAGCAAACCCTGCTGTCATTTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1278s1c1
Sequence:CCGGCACTTTCTTCCTGGAGCTGATCTCGAGATCAGCTCCAGGAAGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032756.2-1535s1c1
Sequence:CCGGCCAGAAGCTGTGTCTCTCATTCTCGAGAATGAGAGACACAGCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032756.2-1442s1c1
Sequence:CCGGCAGCACAGAACTGAGGAACATCTCGAGATGTTCCTCAGTTCTGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1232s1c1
Sequence:CCGGGCAAGTTTCTGCTTCAGGTCTCTCGAGAGACCTGAAGCAGAAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1233s1c1
Sequence:CCGGCAAGTTTCTGCTTCAGGTCTTCTCGAGAAGACCTGAAGCAGAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1209s1c1
Sequence:CCGGGATCCTGCTAGATGGTGATAACTCGAGTTATCACCATCTAGCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032756.2-1225s1c1
Sequence:CCGGGATAAAGGCAAGTTTCTGCTTCTCGAGAAGCAGAAACTTGCCTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032756.2-1215s1c1
Sequence:CCGGGCTAGATGGTGATAAAGGCAACTCGAGTTGCCTTTATCACCATCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146256
HPDL MISSION shRNA Bacterial Glycerol Stock
4-hydroxyphenylpyruvate dioxygenase-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-895s21c1
Sequence:CCGGTTGCAGACTCCGCCGAATAATCTCGAGATTATTCGGCGGAGTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-1189s21c1
Sequence:CCGGGATGGTGATAAAGACGAATTTCTCGAGAAATTCGTCTTTATCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-612s21c1
Sequence:CCGGCTCTCCGGCTGGTAATCTAAGCTCGAGCTTAGATTACCAGCCGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-1090s21c1
Sequence:CCGGACTCCTCCTGAAGCTTATTACCTCGAGGTAATAAGCTTCAGGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146256.3-1387s21c1
Sequence:CCGGACTTGTCCTTGGTGCTCCTTGCTCGAGCAAGGAGCACCAAGGACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-1021s1c1
Sequence:CCGGCGTAGGACTGTACACTCCTAACTCGAGTTAGGAGTGTACAGTCCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-980s1c1
Sequence:CCGGGAGCAATTTCTAACCCGGCATCTCGAGATGCCGGGTTAGAAATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-275s1c1
Sequence:CCGGCACATCGCTTTCCATGTACCACTCGAGTGGTACATGGAAAGCGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146256
HPDL MISSION shRNA shRNA Plasmid DNA
4-hydroxyphenylpyruvate dioxygenase-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-895s21c1
Sequence:CCGGTTGCAGACTCCGCCGAATAATCTCGAGATTATTCGGCGGAGTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-1189s21c1
Sequence:CCGGGATGGTGATAAAGACGAATTTCTCGAGAAATTCGTCTTTATCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-612s21c1
Sequence:CCGGCTCTCCGGCTGGTAATCTAAGCTCGAGCTTAGATTACCAGCCGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-1090s21c1
Sequence:CCGGACTCCTCCTGAAGCTTATTACCTCGAGGTAATAAGCTTCAGGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146256.3-1387s21c1
Sequence:CCGGACTTGTCCTTGGTGCTCCTTGCTCGAGCAAGGAGCACCAAGGACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-1021s1c1
Sequence:CCGGCGTAGGACTGTACACTCCTAACTCGAGTTAGGAGTGTACAGTCCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-980s1c1
Sequence:CCGGGAGCAATTTCTAACCCGGCATCTCGAGATGCCGGGTTAGAAATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-275s1c1
Sequence:CCGGCACATCGCTTTCCATGTACCACTCGAGTGGTACATGGAAAGCGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146256
HPDL MISSION shRNA Lentiviral Transduction Particles
4-hydroxyphenylpyruvate dioxygenase-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-895s21c1
Sequence:CCGGTTGCAGACTCCGCCGAATAATCTCGAGATTATTCGGCGGAGTCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-1189s21c1
Sequence:CCGGGATGGTGATAAAGACGAATTTCTCGAGAAATTCGTCTTTATCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-612s21c1
Sequence:CCGGCTCTCCGGCTGGTAATCTAAGCTCGAGCTTAGATTACCAGCCGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146256.3-1090s21c1
Sequence:CCGGACTCCTCCTGAAGCTTATTACCTCGAGGTAATAAGCTTCAGGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146256.3-1387s21c1
Sequence:CCGGACTTGTCCTTGGTGCTCCTTGCTCGAGCAAGGAGCACCAAGGACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-1021s1c1
Sequence:CCGGCGTAGGACTGTACACTCCTAACTCGAGTTAGGAGTGTACAGTCCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-980s1c1
Sequence:CCGGGAGCAATTTCTAACCCGGCATCTCGAGATGCCGGGTTAGAAATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146256.2-275s1c1
Sequence:CCGGCACATCGCTTTCCATGTACCACTCGAGTGGTACATGGAAAGCGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)