EMAIL THIS PAGE TO A FRIEND

HPGDS

hematopoietic prostaglandin D synthase

51 Gene Product Result for
Synonyms: GSTS GSTS1-1 PGD2 PGDS
UniProtKB ID: O60760, Q6FHT9
Gene ID:
Human(27306) Summary: Prostaglandin-D synthase is a sigma class glutathione-S-transferase family member. The enzyme catalyzes the conversion of PGH2 to PGD2 and plays a role in the production of prostanoids in the immune system and mast cells. The presence of this enzyme can be used to identify the differentiation stage of human megakaryocytes. [provided by RefSeq, Jul 2008]
Mouse(54486) hematopoietic prostaglandin D synthase
Rat(58962) hematopoietic prostaglandin D synthase
domestic guinea pig(100734640) hematopoietic prostaglandin D synthase
naked mole-rat(101706734) hematopoietic prostaglandin D synthase
sheep(101116145) hematopoietic prostaglandin D synthase
chicken(395863) hematopoietic prostaglandin D synthase
cow(100139892) hematopoietic prostaglandin D synthase
domestic cat(101083337) hematopoietic prostaglandin D synthase
dog(478481) hematopoietic prostaglandin D synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS05 GST S1-1, Recombinant Human human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1504 Human HPGDS ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130171 MISSION® esiRNA esiRNA human PGDS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014485 Rosetta Predictions human pricing
NM_031644 Rosetta Predictions rat pricing
NM_019455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345733 predicted 462
2 SASI_Hs01_00198846 predicted 445
3 SASI_Hs01_00198847 predicted 342
4 SASI_Hs01_00198850 predicted 621
5 SASI_Hs01_00198851 predicted 527
6 SASI_Hs01_00198852 predicted 494
7 SASI_Hs01_00198854 predicted 689
8 SASI_Hs01_00198855 predicted 536
9 SASI_Hs02_00345734 predicted 566
10 SASI_Hs02_00345735 predicted 450
11 SASI_Hs01_00198848 predicted 508
12 SASI_Hs01_00198849 predicted 283
13 SASI_Hs01_00198853 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093849 predicted 904
2 SASI_Rn01_00093850 predicted 798
3 SASI_Rn01_00093851 predicted 362
4 SASI_Rn01_00093853 predicted 795
5 SASI_Rn02_00264952 predicted 926
6 SASI_Rn01_00093854 predicted 641
7 SASI_Rn01_00093855 predicted 804
8 SASI_Rn01_00093856 predicted 447
9 SASI_Rn01_00093857 predicted 763
10 SASI_Rn01_00093858 predicted 629
11 SASI_Rn01_00093852 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052982 predicted 602
2 SASI_Mm01_00052983 predicted 483
3 SASI_Mm01_00052984 predicted 509
4 SASI_Mm01_00052985 predicted 598
5 SASI_Mm01_00052986 predicted 485
6 SASI_Mm01_00052987 predicted 716
7 SASI_Mm01_00052988 predicted 747
8 SASI_Mm01_00052989 predicted 470
9 SASI_Mm02_00324441 predicted 636
10 SASI_Mm01_00052990 predicted 661
11 SASI_Mm01_00052991 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014485
HPGDS MISSION shRNA Bacterial Glycerol Stock
hematopoietic prostaglandin D synthase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-1028s21c1
Sequence:CCGGGCTACCACAATTACCTGTAATCTCGAGATTACAGGTAATTGTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-756s21c1
Sequence:CCGGACATCAGCCTGCCAGATAATCCTCGAGGATTATCTGGCAGGCTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-291s1c1
Sequence:CCGGCTCTGGATGATTTCATGTCATCTCGAGATGACATGAAATCATCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-542s1c1
Sequence:CCGGCGGAAGAAAGTCCAAGCCATTCTCGAGAATGGCTTGGACTTTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-77s1c1
Sequence:CCGGGCTTATTTGGACATACAGTATCTCGAGATACTGTATGTCCAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-201s1c1
Sequence:CCGGGCCTAGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-395s1c1
Sequence:CCGGCAAGACTTGGACACATATTTACTCGAGTAAATATGTGTCCAAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-949s21c1
Sequence:CCGGGGTTCTAACATGCACGAATTGCTCGAGCAATTCGTGCATGTTAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014485
HPGDS MISSION shRNA shRNA Plasmid DNA
hematopoietic prostaglandin D synthase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-1028s21c1
Sequence:CCGGGCTACCACAATTACCTGTAATCTCGAGATTACAGGTAATTGTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-756s21c1
Sequence:CCGGACATCAGCCTGCCAGATAATCCTCGAGGATTATCTGGCAGGCTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-291s1c1
Sequence:CCGGCTCTGGATGATTTCATGTCATCTCGAGATGACATGAAATCATCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-542s1c1
Sequence:CCGGCGGAAGAAAGTCCAAGCCATTCTCGAGAATGGCTTGGACTTTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-77s1c1
Sequence:CCGGGCTTATTTGGACATACAGTATCTCGAGATACTGTATGTCCAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-201s1c1
Sequence:CCGGGCCTAGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-395s1c1
Sequence:CCGGCAAGACTTGGACACATATTTACTCGAGTAAATATGTGTCCAAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-949s21c1
Sequence:CCGGGGTTCTAACATGCACGAATTGCTCGAGCAATTCGTGCATGTTAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014485
HPGDS MISSION shRNA Lentiviral Transduction Particles
hematopoietic prostaglandin D synthase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-1028s21c1
Sequence:CCGGGCTACCACAATTACCTGTAATCTCGAGATTACAGGTAATTGTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-756s21c1
Sequence:CCGGACATCAGCCTGCCAGATAATCCTCGAGGATTATCTGGCAGGCTGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-291s1c1
Sequence:CCGGCTCTGGATGATTTCATGTCATCTCGAGATGACATGAAATCATCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-542s1c1
Sequence:CCGGCGGAAGAAAGTCCAAGCCATTCTCGAGAATGGCTTGGACTTTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-77s1c1
Sequence:CCGGGCTTATTTGGACATACAGTATCTCGAGATACTGTATGTCCAAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-201s1c1
Sequence:CCGGGCCTAGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014485.1-395s1c1
Sequence:CCGGCAAGACTTGGACACATATTTACTCGAGTAAATATGTGTCCAAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014485.2-949s21c1
Sequence:CCGGGGTTCTAACATGCACGAATTGCTCGAGCAATTCGTGCATGTTAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019455
VALIDATED
HPGDS MISSION shRNA Bacterial Glycerol Stock
hematopoietic prostaglandin D synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019455.3-865s21c1
Sequence:CCGGGCAGGGAAATAGTTCACAATACTCGAGTATTGTGAACTATTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-109s21c1
Sequence:CCGGAGCCGAAATTATTCGCTACATCTCGAGATGTAGCGAATAATTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-258s21c1
Sequence:CCGGGCCTCGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-560s1c1
Sequence:CCGGGCCTGGCTTGTTGGATATCTACTCGAGTAGATATCCAACAAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-110s1c1
Sequence:CCGGAGCCGAAATTATTCGCTACATCTCGAGATGTAGCGAATAATTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-111s1c1
Sequence:CCGGGCCGAAATTATTCGCTACATACTCGAGTATGTAGCGAATAATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-259s1c1
Sequence:CCGGGCCTCGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-866s1c1
Sequence:CCGGGCAGGGAAATAGTTCACAATACTCGAGTATTGTGAACTATTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-559s21c1
Sequence:CCGGGCCTGGCTTGTTGGATATCTACTCGAGTAGATATCCAACAAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019455
VALIDATED
HPGDS MISSION shRNA shRNA Plasmid DNA
hematopoietic prostaglandin D synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019455.3-865s21c1
Sequence:CCGGGCAGGGAAATAGTTCACAATACTCGAGTATTGTGAACTATTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-109s21c1
Sequence:CCGGAGCCGAAATTATTCGCTACATCTCGAGATGTAGCGAATAATTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-258s21c1
Sequence:CCGGGCCTCGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-560s1c1
Sequence:CCGGGCCTGGCTTGTTGGATATCTACTCGAGTAGATATCCAACAAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-110s1c1
Sequence:CCGGAGCCGAAATTATTCGCTACATCTCGAGATGTAGCGAATAATTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-111s1c1
Sequence:CCGGGCCGAAATTATTCGCTACATACTCGAGTATGTAGCGAATAATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-259s1c1
Sequence:CCGGGCCTCGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-866s1c1
Sequence:CCGGGCAGGGAAATAGTTCACAATACTCGAGTATTGTGAACTATTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-559s21c1
Sequence:CCGGGCCTGGCTTGTTGGATATCTACTCGAGTAGATATCCAACAAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019455
VALIDATED
HPGDS MISSION shRNA Lentiviral Transduction Particles
hematopoietic prostaglandin D synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019455.3-865s21c1
Sequence:CCGGGCAGGGAAATAGTTCACAATACTCGAGTATTGTGAACTATTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-109s21c1
Sequence:CCGGAGCCGAAATTATTCGCTACATCTCGAGATGTAGCGAATAATTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-258s21c1
Sequence:CCGGGCCTCGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-560s1c1
Sequence:CCGGGCCTGGCTTGTTGGATATCTACTCGAGTAGATATCCAACAAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-110s1c1
Sequence:CCGGAGCCGAAATTATTCGCTACATCTCGAGATGTAGCGAATAATTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-111s1c1
Sequence:CCGGGCCGAAATTATTCGCTACATACTCGAGTATGTAGCGAATAATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-259s1c1
Sequence:CCGGGCCTCGCAATAGCAAGATATTCTCGAGAATATCTTGCTATTGCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019455.2-866s1c1
Sequence:CCGGGCAGGGAAATAGTTCACAATACTCGAGTATTGTGAACTATTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019455.3-559s21c1
Sequence:CCGGGCCTGGCTTGTTGGATATCTACTCGAGTAGATATCCAACAAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)