EMAIL THIS PAGE TO A FRIEND

HPN

hepsin

101 Gene Product Result for
Synonyms: TMPRSS1
UniProtKB ID: P05981, B2RDS4
Gene ID:
Human(3249) Summary: This gene encodes a type II transmembrane serine protease that may be involved in diverse cellular functions, including blood coagulation and the maintenance of cell morphology. Expression of the encoded protein is associated with the growth and progression of cancers, particularly prostate cancer. The protein is cleaved into a catalytic serine protease chain and a non-catalytic scavenger receptor cysteine-rich chain, which associate via a single disulfide bond. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(15451) hepsin
Rat(29135) hepsin
dog(484583) hepsin
cow(508148) hepsin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1506 Human Hepsin ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182983 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002151 Rosetta Predictions human pricing
NM_182983 Rosetta Predictions human pricing
NM_017112 Rosetta Predictions rat pricing
NM_001110252 Rosetta Predictions mouse pricing
NM_008281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188152 predicted 1222
2 SASI_Hs02_00333336 predicted 1228
3 SASI_Hs02_00333337 predicted 1417
4 SASI_Hs01_00188154 predicted 559
5 SASI_Hs01_00188155 predicted 664
6 SASI_Hs01_00188156 predicted 765
7 SASI_Hs01_00188157 predicted 960
8 SASI_Hs01_00188158 predicted 1408
9 SASI_Hs02_00333338 predicted 1431
10 SASI_Hs02_00333339 predicted 842
11 SASI_Hs01_00188151 predicted 1310
12 SASI_Hs01_00188153 predicted 1003
13 SASI_Hs01_00188159 predicted 1400
14 SASI_Hs01_00188160 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093069 predicted 2015
2 SASI_Hs01_00093070 predicted 1804
3 SASI_Hs01_00093071 predicted 1814
4 SASI_Hs01_00093072 predicted 1998
5 SASI_Hs01_00093073 predicted 1136
6 SASI_Hs01_00093074 predicted 1244
7 SASI_Hs01_00093075 predicted 1346
8 SASI_Hs01_00093076 predicted 1549
9 SASI_Hs01_00093077 predicted 1985
10 SASI_Hs02_00371155 predicted 2011
11 SASI_Hs01_00093068 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107013 predicted 222
2 SASI_Rn01_00107014 predicted 1405
3 SASI_Rn01_00107015 predicted 308
4 SASI_Rn01_00107016 predicted 1155
5 SASI_Rn01_00107017 predicted 1465
6 SASI_Rn01_00107018 predicted 1196
7 SASI_Rn01_00107019 predicted 1348
8 SASI_Rn01_00107020 predicted 985
9 SASI_Rn02_00261347 predicted 514
10 SASI_Rn02_00261348 predicted 425
11 SASI_Rn01_00107011 predicted 1370
12 SASI_Rn01_00107012 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305166 predicted 910
2 SASI_Mm02_00305167 predicted 1437
3 SASI_Mm02_00305168 predicted 488
4 SASI_Mm02_00305169 predicted 852
5 SASI_Mm02_00305170 predicted 1538
6 SASI_Mm02_00305171 predicted 1247
7 SASI_Mm02_00305172 predicted 1090
8 SASI_Mm02_00305173 predicted 1556
9 SASI_Mm02_00305174 predicted 1365
10 SASI_Mm02_00305175 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077916 predicted 846
2 SASI_Mm02_00313542 predicted 1383
3 SASI_Mm02_00313543 predicted 431
4 SASI_Mm01_00077918 predicted 796
5 SASI_Mm01_00077919 predicted 1487
6 SASI_Mm01_00077920 predicted 1195
7 SASI_Mm01_00077922 predicted 1033
8 SASI_Mm01_00077923 predicted 1497
9 SASI_Mm01_00077924 predicted 1308
10 SASI_Mm02_00313544 predicted 1181
11 SASI_Mm01_00077915 predicted 250
12 SASI_Mm01_00077917 predicted 389
13 SASI_Mm01_00077921 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008281
VALIDATED
HPN MISSION shRNA Bacterial Glycerol Stock
hepsin
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-1395s1c1
Sequence:CCGGGTGGATCTTCAAGGCCATAAACTCGAGTTTATGGCCTTGAAGATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-593s1c1
Sequence:CCGGTGCTGGATGTCATCTCTGTATCTCGAGATACAGAGATGACATCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-277s1c1
Sequence:CCGGCTGCTGTTCCTGACAGGCATTCTCGAGAATGCCTGTCAGGAACAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-941s1c1
Sequence:CCGGGAGACCCTACTATTGACGAAACTCGAGTTTCGTCAATAGTAGGGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1149s21c1
Sequence:CCGGCCCATCATAAGCAACGAAGTTCTCGAGAACTTCGTTGCTTATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-534s1c1
Sequence:CCGGCAACGGCACATCGGGCTTCTTCTCGAGAAGAAGCCCGATGTGCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1368s1c1
Sequence:CCGGGTACACCAAAGTCACTGACTTCTCGAGAAGTCAGTGACTTTGGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1144s1c1
Sequence:CCGGCCCATCATAAGCAACGAAGTTCTCGAGAACTTCGTTGCTTATGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1408s1c1
Sequence:CCGGGCCATAAAGACTCACTCCGAACTCGAGTTCGGAGTGAGTCTTTATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1176s1c1
Sequence:CCGGCGACTTCTACGGGAATCAGATCTCGAGATCTGATTCCCGTAGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-999s1c1
Sequence:CCGGCCTGCCTCTCACAGAATACATCTCGAGATGTATTCTGTGAGAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1400s21c1
Sequence:CCGGGTGGATCTTCAAGGCCATAAACTCGAGTTTATGGCCTTGAAGATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008281.3-539s21c1
Sequence:CCGGCAACGGCACATCGGGCTTCTTCTCGAGAAGAAGCCCGATGTGCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-282s21c1
Sequence:CCGGCTGCTGTTCCTGACAGGCATTCTCGAGAATGCCTGTCAGGAACAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1181s21c1
Sequence:CCGGCGACTTCTACGGGAATCAGATCTCGAGATCTGATTCCCGTAGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008281
VALIDATED
HPN MISSION shRNA shRNA Plasmid DNA
hepsin
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-1395s1c1
Sequence:CCGGGTGGATCTTCAAGGCCATAAACTCGAGTTTATGGCCTTGAAGATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-593s1c1
Sequence:CCGGTGCTGGATGTCATCTCTGTATCTCGAGATACAGAGATGACATCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-277s1c1
Sequence:CCGGCTGCTGTTCCTGACAGGCATTCTCGAGAATGCCTGTCAGGAACAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-941s1c1
Sequence:CCGGGAGACCCTACTATTGACGAAACTCGAGTTTCGTCAATAGTAGGGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1149s21c1
Sequence:CCGGCCCATCATAAGCAACGAAGTTCTCGAGAACTTCGTTGCTTATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-534s1c1
Sequence:CCGGCAACGGCACATCGGGCTTCTTCTCGAGAAGAAGCCCGATGTGCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1368s1c1
Sequence:CCGGGTACACCAAAGTCACTGACTTCTCGAGAAGTCAGTGACTTTGGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1144s1c1
Sequence:CCGGCCCATCATAAGCAACGAAGTTCTCGAGAACTTCGTTGCTTATGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1408s1c1
Sequence:CCGGGCCATAAAGACTCACTCCGAACTCGAGTTCGGAGTGAGTCTTTATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1176s1c1
Sequence:CCGGCGACTTCTACGGGAATCAGATCTCGAGATCTGATTCCCGTAGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-999s1c1
Sequence:CCGGCCTGCCTCTCACAGAATACATCTCGAGATGTATTCTGTGAGAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1400s21c1
Sequence:CCGGGTGGATCTTCAAGGCCATAAACTCGAGTTTATGGCCTTGAAGATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008281.3-539s21c1
Sequence:CCGGCAACGGCACATCGGGCTTCTTCTCGAGAAGAAGCCCGATGTGCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-282s21c1
Sequence:CCGGCTGCTGTTCCTGACAGGCATTCTCGAGAATGCCTGTCAGGAACAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1181s21c1
Sequence:CCGGCGACTTCTACGGGAATCAGATCTCGAGATCTGATTCCCGTAGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008281
VALIDATED
HPN MISSION shRNA Lentiviral Transduction Particles
hepsin
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-1395s1c1
Sequence:CCGGGTGGATCTTCAAGGCCATAAACTCGAGTTTATGGCCTTGAAGATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-593s1c1
Sequence:CCGGTGCTGGATGTCATCTCTGTATCTCGAGATACAGAGATGACATCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-277s1c1
Sequence:CCGGCTGCTGTTCCTGACAGGCATTCTCGAGAATGCCTGTCAGGAACAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-941s1c1
Sequence:CCGGGAGACCCTACTATTGACGAAACTCGAGTTTCGTCAATAGTAGGGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1149s21c1
Sequence:CCGGCCCATCATAAGCAACGAAGTTCTCGAGAACTTCGTTGCTTATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-534s1c1
Sequence:CCGGCAACGGCACATCGGGCTTCTTCTCGAGAAGAAGCCCGATGTGCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1368s1c1
Sequence:CCGGGTACACCAAAGTCACTGACTTCTCGAGAAGTCAGTGACTTTGGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1144s1c1
Sequence:CCGGCCCATCATAAGCAACGAAGTTCTCGAGAACTTCGTTGCTTATGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1408s1c1
Sequence:CCGGGCCATAAAGACTCACTCCGAACTCGAGTTCGGAGTGAGTCTTTATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008281.1-1176s1c1
Sequence:CCGGCGACTTCTACGGGAATCAGATCTCGAGATCTGATTCCCGTAGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008281.1-999s1c1
Sequence:CCGGCCTGCCTCTCACAGAATACATCTCGAGATGTATTCTGTGAGAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1400s21c1
Sequence:CCGGGTGGATCTTCAAGGCCATAAACTCGAGTTTATGGCCTTGAAGATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008281.3-539s21c1
Sequence:CCGGCAACGGCACATCGGGCTTCTTCTCGAGAAGAAGCCCGATGTGCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-282s21c1
Sequence:CCGGCTGCTGTTCCTGACAGGCATTCTCGAGAATGCCTGTCAGGAACAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008281.3-1181s21c1
Sequence:CCGGCGACTTCTACGGGAATCAGATCTCGAGATCTGATTCCCGTAGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182983
HPN MISSION shRNA Bacterial Glycerol Stock
hepsin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-2020s21c1
Sequence:CCGGTGGATCTTCCAGGCCATAAAGCTCGAGCTTTATGGCCTGGAAGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1579s1c1
Sequence:CCGGGAGGAGAACAGCAACGATATTCTCGAGAATATCGTTGCTGTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1577s1c1
Sequence:CCGGGCGAGGAGAACAGCAACGATACTCGAGTATCGTTGCTGTTCTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-900s1c1
Sequence:CCGGCCTGCTACTTCTGACAGCCATCTCGAGATGGCTGTCAGAAGTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1794s1c1
Sequence:CCGGTGGCGCTGACTTCTATGGAAACTCGAGTTTCCATAGAAGTCAGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1720s21c1
Sequence:CCGGACGCAGTACTATGGCCAACAGCTCGAGCTGTTGGCCATAGTACTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1356s21c1
Sequence:CCGGAGTCAGCCTTCGCTATGATGGCTCGAGCCATCATAGCGAAGGCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1992s1c2
Sequence:CCGGCTACACCAAAGTCAGTGACTTCTCGAGAAGTCACTGACTTTGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1004s21c1
Sequence:CCGGACGCTCGGCTCATGGTCTTTGCTCGAGCAAAGACCATGAGCCGAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182983
HPN MISSION shRNA shRNA Plasmid DNA
hepsin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-2020s21c1
Sequence:CCGGTGGATCTTCCAGGCCATAAAGCTCGAGCTTTATGGCCTGGAAGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1579s1c1
Sequence:CCGGGAGGAGAACAGCAACGATATTCTCGAGAATATCGTTGCTGTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1577s1c1
Sequence:CCGGGCGAGGAGAACAGCAACGATACTCGAGTATCGTTGCTGTTCTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-900s1c1
Sequence:CCGGCCTGCTACTTCTGACAGCCATCTCGAGATGGCTGTCAGAAGTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1794s1c1
Sequence:CCGGTGGCGCTGACTTCTATGGAAACTCGAGTTTCCATAGAAGTCAGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1720s21c1
Sequence:CCGGACGCAGTACTATGGCCAACAGCTCGAGCTGTTGGCCATAGTACTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1356s21c1
Sequence:CCGGAGTCAGCCTTCGCTATGATGGCTCGAGCCATCATAGCGAAGGCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1992s1c2
Sequence:CCGGCTACACCAAAGTCAGTGACTTCTCGAGAAGTCACTGACTTTGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1004s21c1
Sequence:CCGGACGCTCGGCTCATGGTCTTTGCTCGAGCAAAGACCATGAGCCGAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182983
HPN MISSION shRNA Lentiviral Transduction Particles
hepsin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-2020s21c1
Sequence:CCGGTGGATCTTCCAGGCCATAAAGCTCGAGCTTTATGGCCTGGAAGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1579s1c1
Sequence:CCGGGAGGAGAACAGCAACGATATTCTCGAGAATATCGTTGCTGTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1577s1c1
Sequence:CCGGGCGAGGAGAACAGCAACGATACTCGAGTATCGTTGCTGTTCTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-900s1c1
Sequence:CCGGCCTGCTACTTCTGACAGCCATCTCGAGATGGCTGTCAGAAGTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1794s1c1
Sequence:CCGGTGGCGCTGACTTCTATGGAAACTCGAGTTTCCATAGAAGTCAGCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1720s21c1
Sequence:CCGGACGCAGTACTATGGCCAACAGCTCGAGCTGTTGGCCATAGTACTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1356s21c1
Sequence:CCGGAGTCAGCCTTCGCTATGATGGCTCGAGCCATCATAGCGAAGGCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182983.1-1992s1c2
Sequence:CCGGCTACACCAAAGTCAGTGACTTCTCGAGAAGTCACTGACTTTGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182983.2-1004s21c1
Sequence:CCGGACGCTCGGCTCATGGTCTTTGCTCGAGCAAAGACCATGAGCCGAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)