EMAIL THIS PAGE TO A FRIEND

HPR

haptoglobin-related protein

33 Gene Product Result for
Synonyms: A-259H10.2 HP
Species: Human HPR(3250), Thale Cress HPR(843129)
UniProtKB ID: P00739, Q7LE20, Q92658, Q92659, Q9ULB0
Gene ID:
Human(3250) Summary: This gene encodes a haptoglobin-related protein that binds hemoglobin as efficiently as haptoglobin. Unlike haptoglobin, plasma concentration of this protein is unaffected in patients with sickle cell anemia and extensive intravascular hemolysis, suggesting a difference in binding between haptoglobin-hemoglobin and haptoglobin-related protein-hemoglobin complexes to CD163, the hemoglobin scavenger receptor. This protein may also be a clinically important predictor of recurrence of breast cancer. [provided by RefSeq, Oct 2011]
Thale Cress(843129) hydroxypyruvate reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0509 AQUA Peptide ILGGHLDA[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020995 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067431 MISSION® esiRNA esiRNA human HPR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020995 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023122 predicted 705
2 SASI_Hs02_00354459 predicted 616
3 SASI_Hs01_00023130 predicted 565
4 SASI_Hs02_00354460 predicted 762
5 SASI_Hs01_00023128 predicted 610
6 SASI_Hs02_00354461 predicted 168
7 SASI_Hs02_00354462 predicted 135
8 SASI_Hs02_00354463 predicted 153
9 SASI_Hs02_00354464 predicted 170
10 SASI_Hs02_00354465 predicted 866
11 SASI_Hs01_00023121 predicted 594
12 SASI_Hs01_00023123 predicted 373
13 SASI_Hs01_00023124 predicted 207
14 SASI_Hs01_00023125 predicted 218
15 SASI_Hs01_00023126 predicted 300
16 SASI_Hs01_00023127 predicted 731
17 SASI_Hs01_00023129 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020995
HPR MISSION shRNA Bacterial Glycerol Stock
haptoglobin-related protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-875s21c1
Sequence:CCGGGTGTCGGCATGTCTAAGTACCCTCGAGGGTACTTAGACATGCCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-86s21c1
Sequence:CCGGCACTGTACTCAGGCAATGATGCTCGAGCATCATTGCCTGAGTACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-766s1c1
Sequence:CCGGGCTGACCAATACGATTGCATACTCGAGTATGCAATCGTATTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-970s1c1
Sequence:CCGGGCTGGGATCCTAAGCTTTGATCTCGAGATCAAAGCTTAGGATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-761s1c1
Sequence:CCGGCTGTGGCTGACCAATACGATTCTCGAGAATCGTATTGGTCAGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-771s1c1
Sequence:CCGGCCAATACGATTGCATAACGCACTCGAGTGCGTTATGCAATCGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-110s1c1
Sequence:CCGGCGGATATTTCAGATGACCGCTCTCGAGAGCGGTCATCTGAAATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-612s21c1
Sequence:CCGGCAAACAGAAGGTGCTTGTTAACTCGAGTTAACAAGCACCTTCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020995
HPR MISSION shRNA shRNA Plasmid DNA
haptoglobin-related protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-875s21c1
Sequence:CCGGGTGTCGGCATGTCTAAGTACCCTCGAGGGTACTTAGACATGCCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-86s21c1
Sequence:CCGGCACTGTACTCAGGCAATGATGCTCGAGCATCATTGCCTGAGTACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-766s1c1
Sequence:CCGGGCTGACCAATACGATTGCATACTCGAGTATGCAATCGTATTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-970s1c1
Sequence:CCGGGCTGGGATCCTAAGCTTTGATCTCGAGATCAAAGCTTAGGATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-761s1c1
Sequence:CCGGCTGTGGCTGACCAATACGATTCTCGAGAATCGTATTGGTCAGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-771s1c1
Sequence:CCGGCCAATACGATTGCATAACGCACTCGAGTGCGTTATGCAATCGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-110s1c1
Sequence:CCGGCGGATATTTCAGATGACCGCTCTCGAGAGCGGTCATCTGAAATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-612s21c1
Sequence:CCGGCAAACAGAAGGTGCTTGTTAACTCGAGTTAACAAGCACCTTCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020995
HPR MISSION shRNA Lentiviral Transduction Particles
haptoglobin-related protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-875s21c1
Sequence:CCGGGTGTCGGCATGTCTAAGTACCCTCGAGGGTACTTAGACATGCCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-86s21c1
Sequence:CCGGCACTGTACTCAGGCAATGATGCTCGAGCATCATTGCCTGAGTACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-766s1c1
Sequence:CCGGGCTGACCAATACGATTGCATACTCGAGTATGCAATCGTATTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-970s1c1
Sequence:CCGGGCTGGGATCCTAAGCTTTGATCTCGAGATCAAAGCTTAGGATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-761s1c1
Sequence:CCGGCTGTGGCTGACCAATACGATTCTCGAGAATCGTATTGGTCAGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-771s1c1
Sequence:CCGGCCAATACGATTGCATAACGCACTCGAGTGCGTTATGCAATCGTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020995.3-110s1c1
Sequence:CCGGCGGATATTTCAGATGACCGCTCTCGAGAGCGGTCATCTGAAATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020995.3-612s21c1
Sequence:CCGGCAAACAGAAGGTGCTTGTTAACTCGAGTTAACAAGCACCTTCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)