EMAIL THIS PAGE TO A FRIEND

HPS1

Hermansky-Pudlak syndrome 1

91 Gene Product Result for
Synonyms: HPS
UniProtKB ID: Q92902, A8MRT2, O15402, O15502, Q5TAA3, Q8WXE5
Gene ID:
Human(3257) Summary: This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is a component of three different protein complexes termed biogenesis of lysosome-related organelles complex (BLOC)-3, BLOC4, and BLOC5. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 1. Multiple transcript variants encoding distinct isoforms have been identified for this gene; the full-length sequences of some of these have not been determined yet. [provided by RefSeq, Jul 2008]
Mouse(192236) Hermansky-Pudlak syndrome 1 homolog (human)
Rat(114638) Hermansky-Pudlak syndrome 1 homolog (human)
Zebrafish(563067) Hermansky-Pudlak syndrome 1
fruit fly(36656) Hermansky-Pudlak Syndrome 1 ortholog
dog(477791) Hermansky-Pudlak syndrome 1
cow(515531) Hermansky-Pudlak syndrome 1
cow(280819) Hermansky-Pudlak syndrome 1
Horse(100070620) Hermansky-Pudlak syndrome 1
domestic cat(101083621) Hermansky-Pudlak syndrome 1
chicken(429879) Hermansky-Pudlak syndrome 1
domestic guinea pig(100723233) Hermansky-Pudlak syndrome 1
naked mole-rat(101710734) Hermansky-Pudlak syndrome 1
sheep(101110375) Hermansky-Pudlak syndrome 1
Domestic Rabbit(100358977) Hermansky-Pudlak syndrome 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000195 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159541 MISSION® esiRNA esiRNA human HPS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000195 Rosetta Predictions human pricing
NM_182637 Rosetta Predictions human pricing
NM_182638 Rosetta Predictions human pricing
NM_182639 Rosetta Predictions human pricing
NM_040669 Rosetta Predictions rat pricing
NM_019424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302047 predicted 405
2 SASI_Hs02_00302048 predicted 482
3 SASI_Hs02_00302049 predicted 891
4 SASI_Hs02_00302050 predicted 894
5 SASI_Hs02_00302051 predicted 888
6 SASI_Hs02_00302052 predicted 576
7 SASI_Hs02_00302053 predicted 607
8 SASI_Hs02_00302054 predicted 613
9 SASI_Hs02_00302055 predicted 619
10 SASI_Hs02_00302056 predicted 775
11 SASI_Hs01_00060584 predicted 1832
12 SASI_Hs01_00060585 predicted 2064
13 SASI_Hs01_00060586 predicted 1689
14 SASI_Hs01_00060587 predicted 1680
15 SASI_Hs01_00060588 predicted 2183
16 SASI_Hs01_00060589 predicted 1682
17 SASI_Hs01_00060590 predicted 2036
18 SASI_Hs01_00060591 predicted 1862
19 SASI_Hs01_00060592 predicted 2079
20 SASI_Hs01_00060593 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094580 predicted 1328
2 SASI_Hs01_00094581 predicted 1072
3 SASI_Hs01_00094582 predicted 801
4 SASI_Hs01_00094583 predicted 951
5 SASI_Hs01_00094584 predicted 943
6 SASI_Hs01_00094585 predicted 1052
7 SASI_Hs01_00094586 predicted 639
8 SASI_Hs01_00094587 predicted 830
9 SASI_Hs01_00094588 predicted 301
10 SASI_Hs01_00094589 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122858 predicted 1292
2 SASI_Hs01_00122859 predicted 1262
3 SASI_Hs01_00122860 predicted 1199
4 SASI_Hs01_00122861 predicted 977
5 SASI_Hs01_00122862 predicted 731
6 SASI_Hs01_00122863 predicted 1288
7 SASI_Hs01_00122864 predicted 1258
8 SASI_Hs01_00122865 predicted 1296
9 SASI_Hs01_00122866 predicted 702
10 SASI_Hs01_00122867 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370785 predicted 489
2 SASI_Hs01_00028849 predicted 909
3 SASI_Hs01_00028852 predicted 892
4 SASI_Hs02_00370786 predicted 408
5 SASI_Hs02_00370787 predicted 577
6 SASI_Hs02_00370788 predicted 609
7 SASI_Hs02_00370789 predicted 423
8 SASI_Hs01_00028855 predicted 628
9 SASI_Hs01_00028856 predicted 786
10 SASI_Hs02_00370790 predicted 624
11 SASI_Hs01_00028848 predicted 1136
12 SASI_Hs01_00028850 predicted 1424
13 SASI_Hs01_00028851 predicted 1370
14 SASI_Hs01_00028853 predicted 1417
15 SASI_Hs01_00028854 predicted 1554
16 SASI_Hs01_00028857 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_040669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061222 predicted 1518
2 SASI_Rn01_00061224 predicted 1938
3 SASI_Rn01_00061225 predicted 1488
4 SASI_Rn01_00061226 predicted 625
5 SASI_Rn02_00265569 predicted 2258
6 SASI_Rn01_00061227 predicted 1907
7 SASI_Rn01_00061228 predicted 702
8 SASI_Rn01_00061229 predicted 301
9 SASI_Rn01_00061230 predicted 1374
10 SASI_Rn01_00061231 predicted 1656
11 SASI_Rn01_00061223 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065987 predicted 2506
2 SASI_Mm01_00065988 predicted 1497
3 SASI_Mm01_00065989 predicted 1658
4 SASI_Mm01_00065990 predicted 2147
5 SASI_Mm01_00065992 predicted 433
6 SASI_Mm01_00065993 predicted 2052
7 SASI_Mm01_00065994 predicted 2360
8 SASI_Mm02_00324348 predicted 632
9 SASI_Mm01_00065995 predicted 1502
10 SASI_Mm01_00065996 predicted 1538
11 SASI_Mm01_00065991 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019424
VALIDATED
HPS1 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019424.2-2502s21c1
Sequence:CCGGGCAGAAGAACGTCTTAGTGCTCTCGAGAGCACTAAGACGTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-450s21c1
Sequence:CCGGGCATCTGTTTGGAGAGTACCTCTCGAGAGGTACTCTCCAAACAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019424.1-1998s1c1
Sequence:CCGGCCTGTGGTTCGAGAATGACATCTCGAGATGTCATTCTCGAACCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-794s1c1
Sequence:CCGGGCAAGCTGTTGGCTTTCTACTCTCGAGAGTAGAAAGCCAACAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-1499s21c1
Sequence:CCGGGCCAGAAGATGGACAAGTTTACTCGAGTAAACTTGTCCATCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-845s21c1
Sequence:CCGGGCAAGCTGTTGGCTTTCTACTCTCGAGAGTAGAAAGCCAACAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-1777s21c1
Sequence:CCGGTTGGTGAAGAGCCGGAGAAATCTCGAGATTTCTCCGGCTCTTCACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019424.1-1889s1c1
Sequence:CCGGCCTTTGTCAAAGCCAAGGTCTCTCGAGAGACCTTGGCTTTGACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-399s1c1
Sequence:CCGGGCATCTGTTTGGAGAGTACCTCTCGAGAGGTACTCTCCAAACAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-2451s1c1
Sequence:CCGGGCAGAAGAACGTCTTAGTGCTCTCGAGAGCACTAAGACGTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-1448s1c1
Sequence:CCGGGCCAGAAGATGGACAAGTTTACTCGAGTAAACTTGTCCATCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019424
VALIDATED
HPS1 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019424.2-2502s21c1
Sequence:CCGGGCAGAAGAACGTCTTAGTGCTCTCGAGAGCACTAAGACGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-450s21c1
Sequence:CCGGGCATCTGTTTGGAGAGTACCTCTCGAGAGGTACTCTCCAAACAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019424.1-1998s1c1
Sequence:CCGGCCTGTGGTTCGAGAATGACATCTCGAGATGTCATTCTCGAACCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-794s1c1
Sequence:CCGGGCAAGCTGTTGGCTTTCTACTCTCGAGAGTAGAAAGCCAACAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-1499s21c1
Sequence:CCGGGCCAGAAGATGGACAAGTTTACTCGAGTAAACTTGTCCATCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-845s21c1
Sequence:CCGGGCAAGCTGTTGGCTTTCTACTCTCGAGAGTAGAAAGCCAACAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-1777s21c1
Sequence:CCGGTTGGTGAAGAGCCGGAGAAATCTCGAGATTTCTCCGGCTCTTCACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019424.1-1889s1c1
Sequence:CCGGCCTTTGTCAAAGCCAAGGTCTCTCGAGAGACCTTGGCTTTGACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-399s1c1
Sequence:CCGGGCATCTGTTTGGAGAGTACCTCTCGAGAGGTACTCTCCAAACAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-2451s1c1
Sequence:CCGGGCAGAAGAACGTCTTAGTGCTCTCGAGAGCACTAAGACGTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-1448s1c1
Sequence:CCGGGCCAGAAGATGGACAAGTTTACTCGAGTAAACTTGTCCATCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019424
VALIDATED
HPS1 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019424.2-2502s21c1
Sequence:CCGGGCAGAAGAACGTCTTAGTGCTCTCGAGAGCACTAAGACGTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-450s21c1
Sequence:CCGGGCATCTGTTTGGAGAGTACCTCTCGAGAGGTACTCTCCAAACAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019424.1-1998s1c1
Sequence:CCGGCCTGTGGTTCGAGAATGACATCTCGAGATGTCATTCTCGAACCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-794s1c1
Sequence:CCGGGCAAGCTGTTGGCTTTCTACTCTCGAGAGTAGAAAGCCAACAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-1499s21c1
Sequence:CCGGGCCAGAAGATGGACAAGTTTACTCGAGTAAACTTGTCCATCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-845s21c1
Sequence:CCGGGCAAGCTGTTGGCTTTCTACTCTCGAGAGTAGAAAGCCAACAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019424.2-1777s21c1
Sequence:CCGGTTGGTGAAGAGCCGGAGAAATCTCGAGATTTCTCCGGCTCTTCACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019424.1-1889s1c1
Sequence:CCGGCCTTTGTCAAAGCCAAGGTCTCTCGAGAGACCTTGGCTTTGACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-399s1c1
Sequence:CCGGGCATCTGTTTGGAGAGTACCTCTCGAGAGGTACTCTCCAAACAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-2451s1c1
Sequence:CCGGGCAGAAGAACGTCTTAGTGCTCTCGAGAGCACTAAGACGTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019424.1-1448s1c1
Sequence:CCGGGCCAGAAGATGGACAAGTTTACTCGAGTAAACTTGTCCATCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000195
HPS1 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1582s21c1
Sequence:GTACCGGAGCACCTGGCTGGAGTTTAAGCTCGAGCTTAAACTCCAGCCAGGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-577s1c1
Sequence:CCGGGTGCTCAAGTACCTGTTTGAACTCGAGTTCAAACAGGTACTTGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-622s21c1
Sequence:GTACCGGGACGGTCATCTTATCCGAAAGCTCGAGCTTTCGGATAAGATGACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000195.2-2860s1c1
Sequence:CCGGGCTCAATAAATGTTGGTCATTCTCGAGAATGACCAACATTTATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-2082s1c1
Sequence:CCGGCCTGTGGTTCGAGAATGACATCTCGAGATGTCATTCTCGAACCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-483s1c1
Sequence:CCGGCCTGTATGTCCTTCACCTGTTCTCGAGAACAGGTGAAGGACATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-283s1c1
Sequence:CCGGGTCCTCTTCTACTGGACAGATCTCGAGATCTGTCCAGTAGAAGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-492s21c1
Sequence:GTACCGGCCTTCACCTGTTTGGAGAATGCTCGAGCATTCTCCAAACAGGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1217s21c1
Sequence:GTACCGGCCATGGATGCCCTTCAGATAGCTCGAGCTATCTGAAGGGCATCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-2078s21c1
Sequence:GTACCGGACTTCCTGTGGTTCGAGAATGCTCGAGCATTCTCGAACCACAGGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-293s21c1
Sequence:GTACCGGACTGGACAGATCAGGAGTTTGCTCGAGCAAACTCCTGATCTGTCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1532s21c1
Sequence:GTACCGGGCCAGAGGATGGACAAGTTTGCTCGAGCAAACTTGTCCATCCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1865s21c1
Sequence:GTACCGGGCTTGGTGCACTTCATCTATGCTCGAGCATAGATGAAGTGCACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000195
HPS1 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1582s21c1
Sequence:GTACCGGAGCACCTGGCTGGAGTTTAAGCTCGAGCTTAAACTCCAGCCAGGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-577s1c1
Sequence:CCGGGTGCTCAAGTACCTGTTTGAACTCGAGTTCAAACAGGTACTTGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-622s21c1
Sequence:GTACCGGGACGGTCATCTTATCCGAAAGCTCGAGCTTTCGGATAAGATGACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000195.2-2860s1c1
Sequence:CCGGGCTCAATAAATGTTGGTCATTCTCGAGAATGACCAACATTTATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-2082s1c1
Sequence:CCGGCCTGTGGTTCGAGAATGACATCTCGAGATGTCATTCTCGAACCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-483s1c1
Sequence:CCGGCCTGTATGTCCTTCACCTGTTCTCGAGAACAGGTGAAGGACATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-283s1c1
Sequence:CCGGGTCCTCTTCTACTGGACAGATCTCGAGATCTGTCCAGTAGAAGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-492s21c1
Sequence:GTACCGGCCTTCACCTGTTTGGAGAATGCTCGAGCATTCTCCAAACAGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1217s21c1
Sequence:GTACCGGCCATGGATGCCCTTCAGATAGCTCGAGCTATCTGAAGGGCATCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-2078s21c1
Sequence:GTACCGGACTTCCTGTGGTTCGAGAATGCTCGAGCATTCTCGAACCACAGGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-293s21c1
Sequence:GTACCGGACTGGACAGATCAGGAGTTTGCTCGAGCAAACTCCTGATCTGTCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1532s21c1
Sequence:GTACCGGGCCAGAGGATGGACAAGTTTGCTCGAGCAAACTTGTCCATCCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1865s21c1
Sequence:GTACCGGGCTTGGTGCACTTCATCTATGCTCGAGCATAGATGAAGTGCACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000195
HPS1 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1582s21c1
Sequence:GTACCGGAGCACCTGGCTGGAGTTTAAGCTCGAGCTTAAACTCCAGCCAGGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-577s1c1
Sequence:CCGGGTGCTCAAGTACCTGTTTGAACTCGAGTTCAAACAGGTACTTGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-622s21c1
Sequence:GTACCGGGACGGTCATCTTATCCGAAAGCTCGAGCTTTCGGATAAGATGACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000195.2-2860s1c1
Sequence:CCGGGCTCAATAAATGTTGGTCATTCTCGAGAATGACCAACATTTATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-2082s1c1
Sequence:CCGGCCTGTGGTTCGAGAATGACATCTCGAGATGTCATTCTCGAACCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-483s1c1
Sequence:CCGGCCTGTATGTCCTTCACCTGTTCTCGAGAACAGGTGAAGGACATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000195.2-283s1c1
Sequence:CCGGGTCCTCTTCTACTGGACAGATCTCGAGATCTGTCCAGTAGAAGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-492s21c1
Sequence:GTACCGGCCTTCACCTGTTTGGAGAATGCTCGAGCATTCTCCAAACAGGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1217s21c1
Sequence:GTACCGGCCATGGATGCCCTTCAGATAGCTCGAGCTATCTGAAGGGCATCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-2078s21c1
Sequence:GTACCGGACTTCCTGTGGTTCGAGAATGCTCGAGCATTCTCGAACCACAGGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-293s21c1
Sequence:GTACCGGACTGGACAGATCAGGAGTTTGCTCGAGCAAACTCCTGATCTGTCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1532s21c1
Sequence:GTACCGGGCCAGAGGATGGACAAGTTTGCTCGAGCAAACTTGTCCATCCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000195.2-1865s21c1
Sequence:GTACCGGGCTTGGTGCACTTCATCTATGCTCGAGCATAGATGAAGTGCACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)