EMAIL THIS PAGE TO A FRIEND

HPS3

Hermansky-Pudlak syndrome 3

61 Gene Product Result for
Synonyms: SUTAL
UniProtKB ID: Q969F9, A8K6G6, Q8WTV6, Q96AP1, Q96MR3, Q9H608
Gene ID:
Human(84343) Summary: This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. Alternate splice variants exist, but their full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12807) Hermansky-Pudlak syndrome 3 homolog (human)
Rat(310288) Hermansky-Pudlak syndrome 3 homolog (human)
sheep(101122241) Hermansky-Pudlak syndrome 3
Domestic Rabbit(100339408) Hermansky-Pudlak syndrome 3
domestic guinea pig(100716761) Hermansky-Pudlak syndrome 3
naked mole-rat(101717679) Hermansky-Pudlak syndrome 3
Zebrafish(777758) Hermansky-Pudlak syndrome 3
cow(783104) Hermansky-Pudlak syndrome 3
Horse(100058614) Hermansky-Pudlak syndrome 3
dog(485709) Hermansky-Pudlak syndrome 3
chicken(425047) Hermansky-Pudlak syndrome 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032383 Rosetta Predictions human pricing
NM_001107664 Rosetta Predictions rat pricing
NM_080634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060404 predicted 656
2 SASI_Hs01_00060405 predicted 1233
3 SASI_Hs01_00060407 predicted 2296
4 SASI_Hs01_00060408 predicted 1932
5 SASI_Hs02_00359778 predicted 2604
6 SASI_Hs01_00060410 predicted 2793
7 SASI_Hs01_00060413 predicted 2543
8 SASI_Hs02_00359779 predicted 1198
9 SASI_Hs02_00359780 predicted 1262
10 SASI_Hs02_00359781 predicted 1037
11 SASI_Hs01_00060406 predicted 2889
12 SASI_Hs01_00060409 predicted 3006
13 SASI_Hs01_00060411 predicted 2110
14 SASI_Hs01_00060412 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231055 predicted 3046
2 SASI_Rn02_00231056 predicted 961
3 SASI_Rn02_00231057 predicted 1432
4 SASI_Rn02_00231058 predicted 2207
5 SASI_Rn02_00231059 predicted 1531
6 SASI_Rn02_00231060 predicted 2550
7 SASI_Rn02_00231061 predicted 2004
8 SASI_Rn02_00231062 predicted 1836
9 SASI_Rn02_00231063 predicted 544
10 SASI_Rn02_00231064 predicted 1960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200660 predicted 874
2 SASI_Mm01_00200661 predicted 1677
3 SASI_Mm01_00200662 predicted 1090
4 SASI_Mm02_00338178 predicted 531
5 SASI_Mm02_00338179 predicted 2544
6 SASI_Mm01_00200664 predicted 263
7 SASI_Mm01_00200665 predicted 295
8 SASI_Mm01_00200666 predicted 1220
9 SASI_Mm01_00200667 predicted 1329
10 SASI_Mm01_00200669 predicted 2508
11 SASI_Mm01_00200663 predicted 915
12 SASI_Mm01_00200668 predicted 2540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080634
VALIDATED
HPS3 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-2502s21c1
Sequence:CCGGCAGTCATTATGGCCTAGTAAACTCGAGTTTACTAGGCCATAATGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-2761s21c1
Sequence:CCGGGCCGTCATTGCGTATGCTAATCTCGAGATTAGCATACGCAATGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-3475s21c1
Sequence:CCGGCTCGTCAAACAATACCTTAATCTCGAGATTAAGGTATTGTTTGACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-870s21c1
Sequence:CCGGTTTACGTGTTCGGCATCTATTCTCGAGAATAGATGCCGAACACGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-1721s21c1
Sequence:CCGGATCTCGCCTTGCCGTACTATACTCGAGTATAGTACGGCAAGGCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080634
VALIDATED
HPS3 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-2502s21c1
Sequence:CCGGCAGTCATTATGGCCTAGTAAACTCGAGTTTACTAGGCCATAATGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-2761s21c1
Sequence:CCGGGCCGTCATTGCGTATGCTAATCTCGAGATTAGCATACGCAATGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-3475s21c1
Sequence:CCGGCTCGTCAAACAATACCTTAATCTCGAGATTAAGGTATTGTTTGACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-870s21c1
Sequence:CCGGTTTACGTGTTCGGCATCTATTCTCGAGAATAGATGCCGAACACGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-1721s21c1
Sequence:CCGGATCTCGCCTTGCCGTACTATACTCGAGTATAGTACGGCAAGGCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080634
VALIDATED
HPS3 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-2502s21c1
Sequence:CCGGCAGTCATTATGGCCTAGTAAACTCGAGTTTACTAGGCCATAATGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-2761s21c1
Sequence:CCGGGCCGTCATTGCGTATGCTAATCTCGAGATTAGCATACGCAATGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-3475s21c1
Sequence:CCGGCTCGTCAAACAATACCTTAATCTCGAGATTAAGGTATTGTTTGACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-870s21c1
Sequence:CCGGTTTACGTGTTCGGCATCTATTCTCGAGAATAGATGCCGAACACGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_080634.3-1721s21c1
Sequence:CCGGATCTCGCCTTGCCGTACTATACTCGAGTATAGTACGGCAAGGCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032383
VALIDATED
HPS3 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-2656s21c1
Sequence:CCGGCATGGGTTCACGTCGTAATATCTCGAGATATTACGACGTGAACCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-817s21c1
Sequence:CCGGATAAGACCAACAATCGAATAACTCGAGTTATTCGATTGTTGGTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-347s21c1
Sequence:CCGGCAGCGAGGCTGGAGATTATTTCTCGAGAAATAATCTCCAGCCTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-456s21c1
Sequence:CCGGATCCGAATGATTGGGCATAATCTCGAGATTATGCCCAATCATTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032383.3-3323s21c1
Sequence:CCGGTACCGTGTAGTGGTAACTATTCTCGAGAATAGTTACCACTACACGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032383.3-2630s1c1
Sequence:CCGGCTGTAGTCATTATGGCTTAATCTCGAGATTAAGCCATAATGACTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032383.3-1289s1c1
Sequence:CCGGGCACGTCATTACAAGTAACAACTCGAGTTGTTACTTGTAATGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_032383.3-1032s1c1
Sequence:CCGGGCTCCTGATATTTCGTCCTATCTCGAGATAGGACGAAATATCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032383.3-2628s1c1
Sequence:CCGGGCCTGTAGTCATTATGGCTTACTCGAGTAAGCCATAATGACTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032383.3-3704s1c1
Sequence:CCGGGCTCTGTTTCTCTGAATCAAACTCGAGTTTGATTCAGAGAAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032383
VALIDATED
HPS3 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-2656s21c1
Sequence:CCGGCATGGGTTCACGTCGTAATATCTCGAGATATTACGACGTGAACCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-817s21c1
Sequence:CCGGATAAGACCAACAATCGAATAACTCGAGTTATTCGATTGTTGGTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-347s21c1
Sequence:CCGGCAGCGAGGCTGGAGATTATTTCTCGAGAAATAATCTCCAGCCTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-456s21c1
Sequence:CCGGATCCGAATGATTGGGCATAATCTCGAGATTATGCCCAATCATTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032383.3-3323s21c1
Sequence:CCGGTACCGTGTAGTGGTAACTATTCTCGAGAATAGTTACCACTACACGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032383.3-2630s1c1
Sequence:CCGGCTGTAGTCATTATGGCTTAATCTCGAGATTAAGCCATAATGACTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032383.3-1289s1c1
Sequence:CCGGGCACGTCATTACAAGTAACAACTCGAGTTGTTACTTGTAATGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_032383.3-1032s1c1
Sequence:CCGGGCTCCTGATATTTCGTCCTATCTCGAGATAGGACGAAATATCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032383.3-2628s1c1
Sequence:CCGGGCCTGTAGTCATTATGGCTTACTCGAGTAAGCCATAATGACTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032383.3-3704s1c1
Sequence:CCGGGCTCTGTTTCTCTGAATCAAACTCGAGTTTGATTCAGAGAAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032383
VALIDATED
HPS3 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-2656s21c1
Sequence:CCGGCATGGGTTCACGTCGTAATATCTCGAGATATTACGACGTGAACCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-817s21c1
Sequence:CCGGATAAGACCAACAATCGAATAACTCGAGTTATTCGATTGTTGGTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-347s21c1
Sequence:CCGGCAGCGAGGCTGGAGATTATTTCTCGAGAAATAATCTCCAGCCTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032383.3-456s21c1
Sequence:CCGGATCCGAATGATTGGGCATAATCTCGAGATTATGCCCAATCATTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032383.3-3323s21c1
Sequence:CCGGTACCGTGTAGTGGTAACTATTCTCGAGAATAGTTACCACTACACGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032383.3-2630s1c1
Sequence:CCGGCTGTAGTCATTATGGCTTAATCTCGAGATTAAGCCATAATGACTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032383.3-1289s1c1
Sequence:CCGGGCACGTCATTACAAGTAACAACTCGAGTTGTTACTTGTAATGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_032383.3-1032s1c1
Sequence:CCGGGCTCCTGATATTTCGTCCTATCTCGAGATAGGACGAAATATCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032383.3-2628s1c1
Sequence:CCGGGCCTGTAGTCATTATGGCTTACTCGAGTAAGCCATAATGACTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032383.3-3704s1c1
Sequence:CCGGGCTCTGTTTCTCTGAATCAAACTCGAGTTTGATTCAGAGAAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)